Sign in

Jorge Ferrer

@jorge-ferrer.bsky.social
437 followers 369 following 18 posts

Interested in how genome regulation and genetics shape β cells and diabetes pathways (and just as excited about each of these on their own) Centre for Genomic Regulation – CRG, Barcelona. Imperial College London; CIBERDEM

PostsRepliesMedia
Reposted by Jorge Ferrer
Ferenc Mueller @ferencmueller.bsky.social · 01/06/2026
Join is in Budapest in October! For the 6th time, all things epigenetics, gene and genome regulation and more. A fantastic opportunity to present, to talk to speakers and colleagues in a friendly, informal setting at a great location. Please note, travel grant deadline will expire soon.
01512
Reposted by Jorge Ferrer
Parc de Recerca Biomèdica de Barcelona @prbb.org · 21/05/2026
📣 New PRBB-CRG conference 📋 Mapping progenitor niche dynamics for regulation of cell fate 🗣️ Francesca Spagnoli (@labspagnoli.bsky.social) - @kingscollegelondon.bsky.social  📆 May 22 - ⏰ 12:00 hosted by: @jorge-ferrer.bsky.social  - @crg.eu    📍 #PRBB Maria Skłodowska-Curie room
021
Reposted by Jorge Ferrer
Ben Lehner @benlehner.bsky.social · 23/10/2025
TF-MAPS: fast high-resolution functional and allosteric mapping of DNA-binding proteins by @XianghuaLi2 Are Transcription Factors really 'undruggable'? www.biorxiv.org/content/10.1...
biorxiv.org
TF-MAPS: fast high-resolution functional and allosteric mapping of DNA-binding proteins
Transcription factors (TFs) bind specific DNA sequences to control gene expression. Modulating TF activity is of considerable therapeutic interest but very few TFs have been successfully drugged. TF D...
13014
Jorge Ferrer @jorge-ferrer.bsky.social · 23/10/2025
Many exciting opportunities for a PhD in Life Sciences in CRG, Barcelona. If you are interested in Genomics of Diabetes check out the offer for a fully funded fellowship in our lab - we will consider candidates with experimental or computational backgrounds. Please spread the word!
087
Reposted by Jorge Ferrer
Tom Fletcher @tomfletcherun.bsky.social · 22/08/2025
The Gaza Famine is the world’s famine. A preventable, predictable famine. Enough. Ceasefire. Open all crossings, north and south. Let us get food in, unimpeded and at massive scale.
15581341
Reposted by Jorge Ferrer
Daniel Drucker @danieljdrucker.bsky.social · 07/08/2025
A HNF1A-A1CF transcription-splicing axis is suppressed in β cells from #T2D individuals, while genetic variants reducing pancreatic islet A1CF are associated with increased glycemia and T2D susceptibility www.cell.com/cell-metabol...
cell.com
HNF1A and A1CF coordinate a beta cell transcription-splicing axis that is disrupted in type 2 diabetes
Bernardo et al. uncover a transcription-splicing regulatory axis driven by HNF1A and A1CF in pancreatic β cells. Targeted perturbations, single-cell studies, and human genetic evidence demonstrate tha...
092
Jorge Ferrer @jorge-ferrer.bsky.social · 06/08/2025
An HNF1A-A1CF transcription splicing axis regulates insulin secretion, and breaks down in T2D. Amazing work led by Edgar Bernardo + Matias de Vas + major contributions from Diego Balboa, Silvia Bonas, Mirabai Cuenca, Fanny Mollandin, Merce Planas, Miquel Torrent, MA Maestro and many others
cell.com
HNF1A and A1CF coordinate a beta cell transcription-splicing axis that is disrupted in type 2 diabetes
Bernardo et al. uncover a transcription-splicing regulatory axis driven by HNF1A and A1CF in pancreatic β cells. Targeted perturbations, single-cell studies, and human genetic evidence demonstrate tha...
071
Reposted by Jorge Ferrer
Mikael Marttinen @mmarttinen.bsky.social · 26/05/2025
SUM-seq out @natmethods.nature.com !
 🚀 Ultra-high-throughput Multiplexed snATAC+RNA Used to: ⏳ link temporal macrophage GRNs to immune disease genetics 🩸 map T cell regulatory landscapes 🧬✂️ dissect TF function in hiPSC differentiation via CRISPRi/a screens doi.org/10.1038/s41592-025-02700-8 🧵
doi.org
Single-cell ultra-high-throughput multiplexed chromatin and RNA profiling reveals gene regulatory dynamics - Nature Methods
This work presents SUM-seq, an ultra-high-throughput method for co-profiling chromatin accessibility and gene expression in single nuclei across multiplexed samples, advancing the study of gene regula...
14517
Reposted by Jorge Ferrer
Carl T. Bergstrom @carlbergstrom.com · 26/05/2025
These are VERY rough estimates, but here's life expectancy after diagnosis of type-I diabetes over the past 150 years. It was Banting and Best's discovery of how to isolate insulin in 1921 — not some fucking cooking class — that gave people including my daughter a new lease on life.
Plot of life expectancy after Type 1 diabetes diagnosis, 1850-2025. 

After the discovery of insulin in 1921, life expectancies go gradually from zero to seventy years.
423873717
Jorge Ferrer @jorge-ferrer.bsky.social · 26/05/2025
Congratulations for this study in @Dev_journal, no small feat in Argentina's anti-Science climate
042
Reposted by Jorge Ferrer
Jonathan Frazer @jonnyfrazer.bsky.social · 26/05/2025
Want to improve your protein or genomic language model’s performance at zero-shot variant effect prediction? We propose a simple adjustment to likelihood-based predicton
0246
Reposted by Jorge Ferrer
Nadia Halidi @nadiahalidi.bsky.social · 26/05/2025
📣 Join us @ ALMU! If you have expertise in SMLM, experience in building bespoke microscope systems -or you're excited to start building- are familiar with Python, and have a passion for optical microscopy, we’d love to hear from you! 👇 recruitment.crg.eu/content/jobs... Reposts appreciated-Thanks!
012
Jorge Ferrer @jorge-ferrer.bsky.social · 26/05/2025
Tracing human clones and lineages with DNA methylation. Congratulations for this fascinating breakthrough!
161
Reposted by Jorge Ferrer
Ronny Helman @ronnyhelman.bsky.social · 18/05/2025
Happy to share a work from the Helman lab on how beta cells sense and control their insulin secretion by Krell et al. in @CellReports. Beta cells intrinsically sense and limit their secretory activity via mTORC1-RhoA signaling: Cell Reports www.cell.com/cell-reports...
cell.com
Beta cells intrinsically sense and limit their secretory activity via mTORC1-RhoA signaling
Krell et al. show that mTORC1 in β cells acts as an activity sensor, activated by the same signals that trigger insulin secretion. This activation, in turn, inhibits insulin release via RhoA-dependent...
0165
Reposted by Jorge Ferrer
Patrick MacDonald🇨🇦 @bcellorg.bsky.social · 19/04/2025
Molecular Correlates of Glycine Receptor Activity in Human β Cells www.sciencedirect.com/science/artic…
084
Reposted by Jorge Ferrer
Adam Berinsky @adamberinsky.bsky.social · 19/04/2025
Just heard from the VP research that my grant with @dgrand.bsky.social, "Promoting Accurate Information on Social Media" was terminated as well
1220590
Reposted by Jorge Ferrer
Itai Yanai @itaiyanai.bsky.social · 11/04/2025
Is the genome just a bag of genes? A new paper in Science now reports that for two thirds of an organisms' genes the position along the chromosome is actually very tightly constrained! Amazing work from my favorite night scientist Martin Lercher and his team! www.science.org/doi/10.1126/...
110230
Reposted by Jorge Ferrer
Spagnoli_Lab. @labspagnoli.bsky.social · 17/04/2025
🚨🚨 New pre-print from the lab. led by the amazing @alejotorrescano.bsky.social ! Alejo & Co. elegantly decode the spatial logic of progenitor cell organization in the developing pancreas — from individual cells to structured cellular communities 🔬🔬🧫🧪 Check-it out ⤵️
22210
Jorge Ferrer @jorge-ferrer.bsky.social · 27/03/2025
@elpais.com Many established US scientists are taking a bold decision to move to Europe. EU is devoting funding to this but should be more ambitious elpais.com/ciencia/2025...
elpais.com
Hablan los científicos que quieren emigrar a España por Trump: “Tengo miedo al fascismo”
Centros punteros de Barcelona y Madrid reciben decenas de solicitudes de investigadores en Estados Unidos
020
Reposted by Jorge Ferrer
Nature Biotechnology @natbiotech.nature.com · 13/03/2025
Accuracy of gene regulatory network inference is increased by combining multiome single-cell and atlas-scale bulk data go.nature.com/43YySqO rdcu.be/ebBio
go.nature.com
Inferring gene regulatory networks from single-cell multiome data using atlas-scale external data - Nature Biotechnology
Accuracy of gene regulatory network inference is increased by combining multiome single-cell and atlas-scale bulk data.
0115
Reposted by Jorge Ferrer
Ildem Akerman Lab @akermanlab.bsky.social · 11/03/2025
We are looking for a keen bioinformatician for a fully funded PhD position! Drop me an email with your CV! www.findaphd.com/phds/project...
findaphd.com
PhD Opportunity in Bioinformatics – Fully Funded for UK Home Fee Students at University of Birmingham on FindAPhD.com
PhD Project - PhD Opportunity in Bioinformatics – Fully Funded for UK Home Fee Students at University of Birmingham, listed on FindAPhD.com
012
Jorge Ferrer @jorge-ferrer.bsky.social · 06/03/2025
*last day* to register and submit your work in topics relevant to liver and islets in metabolic disease, including… - organoid models, regeneration, and synthetic biology - disease mechanisms and therapies - genome regulation - ….others
032
Reposted by Jorge Ferrer
Emma R Andersson @anderssonlab.bsky.social · 05/03/2025
Join the exciting EMBO Workshop on Liver and Pancreas in Metabolic Disease, which brings together top-tier speakers in an outstanding seaside venue in April 🌊🌅. We’ve designed an interactive and engaging program—register now before it’s too late! ⏳👉 meetings.embo.org/event/25-liv...
meetings.embo.org
Liver and pancreas in metabolic disease: from pathways to therapies
The liver and pancreas arise from a common developmental origin and are controlled by shared gene regulatory programs.These organs are central to two of the most common and devastating metabolic dise…
066
Reposted by Jorge Ferrer
Boris Lenhard @borislenhard.bsky.social · 02/12/2024
Great work by @sviatoslavsidorov.bsky.social !
053
Jorge Ferrer @jorge-ferrer.bsky.social · 02/02/2025
Still time to apply! Applications from US welcome – four years can feel longer or shorter depending on where you are 😉
01313
Reposted by Jorge Ferrer
Heiko Lickert @heikolickert.bsky.social · 21/01/2025
Application deadline is get closer - make sure you do not miss this exciting EMBO workshop on liver and pancreatic biology and disease 😉 meetings.embo.org/event/25-liv...
meetings.embo.org
Liver and pancreas in metabolic disease: from pathways to therapies
The liver and pancreas arise from a common developmental origin and are controlled by shared gene regulatory programs.These organs are central to two of the most common and devastating metabolic dise…
01210
Jorge Ferrer @jorge-ferrer.bsky.social · 01/02/2025
If the past two meetings are any indication, this promises to be another great genome regulation workshop
010
Reposted by Jorge Ferrer
Marieke Oudelaar @mariekeoudelaar.bsky.social · 17/01/2025
Two great articles in Mol Cell about enhancer cooperativity & long-range enhancer activation by @chribue.bsky.social & Wysocka labs: www.sciencedirect.com/science/arti... www.sciencedirect.com/science/arti... Dimitra and I had the pleasure to write a Preview: www.sciencedirect.com/science/arti...
sciencedirect.com
Bridging the gap: How enhancers cooperate to regulate gene expression over large genomic distances
By building synthetic regulatory landscapes, Jensen et al.1 and Thomas et al.2 demonstrate in this issue of Molecular Cell that gene expression levels…
04615
Reposted by Jorge Ferrer
Genetics Society UK @gensocuk.bsky.social · 17/01/2025
Join us in Belfast for our #epigenetics meeting and hear from fantastic speakers. Submit an abstract until 26 Jan and register until 23 Feb! Don't miss this chance to share your research & network with experts in the field. genetics.org.uk/events/epige...
genetics.org.uk
Epigenetics-2025, from mechanisms to disease | Genetics Society
Meeting background This international conference will bring together leading experts to foster dynamic discussions on the latest breakthroughs in epigenetics. It will cover mechanisms of epigenetic re...
0148
Reposted by Jorge Ferrer
Francis Lynn 🇨🇦 @nictitate.bsky.social · 08/01/2025
If you’re interested in doing Postdoc work in Vancouver this is a great opportunity, check out our website and get in touch soon (www.betacell.ca)!
058
Reposted by Jorge Ferrer
Centre de Regulació Genòmica (CRG) @crg.eu · 08/01/2025
Introducing Human Domainome v1, the largest and most comprehensive library of human protein variants to date, which maps the effects of +500K mutations across 522 domains. The study by @benlehner.bsky.social and Toni Beltran is out now in @nature.com. Illustration by @queralttolosa.bsky.social.
13411
Reposted by Jorge Ferrer
Nicky Whiffin @nickywhiffin.bsky.social · 07/01/2025
Well isn't this cool??? www.medrxiv.org/content/10.1... Variants in RNU4-2 and RNU6 paralogues could account for up to 1.2% of undiagnosed retinitis pigmentosa cases! Really neat example of pleiotropy: different RNU4-2 variants underlie neurodevelopmental disorder (ReNU syndrome) and RP. 🤓🧬🖥️🩺❤️
medrxiv.org
43315
Reposted by Jorge Ferrer
Bart Deplancke @bartdeplancke.bsky.social · 06/01/2025
Superb work by Wouter @Zouters & @OlgaPushkarev developing ChromatinHD, two scale-adaptive #machinelearning models & interpretation tools that use #scRNAseq + #scATACseq data to better understand how chromatin accessibility relates to gene expression doi.org/10.1038/s414... Happy 2025 everyone 🎆 !
doi.org
ChromatinHD connects single-cell DNA accessibility and conformation to gene expression through scale-adaptive machine learning - Nature Communications
Functional chromatin changes occur at different scales. Here, the authors introduce ChromatinHD, a method that characterises differential and predictive chromatin accessibility changes in a scale-adap...
17627
Reposted by Jorge Ferrer
Manuel Irimia @mirimiam.bsky.social · 23/12/2024
🚨🚨🚨 If you're a bioinformatician who loves: 🧬 #SingleCell #LongReadSequencing & #AlternativeSplicing 🚀 Collaborating and travelling Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu-@crg.eu in Barcelona. Qs: www.transdevolab.com Please RT! 🙏
02528
Jorge Ferrer @jorge-ferrer.bsky.social · 31/12/2024
📣 Hiring, please forward widely!! Two postdoc openings to work on genomics of diabetes 1. Computational regulatory genomics/statistical genetics. 2. Experimental cell-based modeling DM if interested @crg.eu shorturl.at/O3wMi shorturl.at/ieyZy
shorturl.at
Postdoctoral scientist, gene regulatory mechanisms and diabetes | CRG Online Recruitment Portal
The Centre for Genomic Regulation (CRG) is an international biomedical research institute of excellence, based in Barcelona, Spain, with more than 400 scientists from 44 countries. The CRG is composed by an interdisciplinary, motivated and creative scientific team which is supported both by a flexible and efficient administration and by high-end and innovative technologies.
1616
Jorge Ferrer @jorge-ferrer.bsky.social · 21/12/2024
Join us in a beautiful location for this multidisciplinary experience. Top speakers linking topics such as organoid modeling, synthetic biology, gene regulation or genetics with disease mechanisms & new therapies for T1D, T2D, and MASLD meetings.embo.org/event/25-liver-pancreas
meetings.embo.org
Liver and pancreas in metabolic disease: from pathways to therapies
The liver and pancreas arise from a common developmental origin and are controlled by shared gene regulatory programs.These organs are central to two of the most common and devastating metabolic dise…
21712
Reposted by Jorge Ferrer
Heiko Lickert @heikolickert.bsky.social · 19/12/2024
My top highlight for 2025 - EMBO workshop in Saint Feliu - three exciting days of science crossing boundaries of liver & pancreas research! Co-organised by @CebolaLab @1jorgeferrer @VallierLab @LickertHeiko & Emma Anderson #livertwitter #islets #masld #diabetes meetings.embo.org/event/25-liv...
meetings.embo.org
Liver and pancreas in metabolic disease: from pathways to therapies
The liver and pancreas arise from a common developmental origin and are controlled by shared gene regulatory programs.These organs are central to two of the most common and devastating metabolic dise…
0159
Reposted by Jorge Ferrer
Ildem Akerman Lab @akermanlab.bsky.social · 19/12/2024
Fancy 4 more years of beta cells? We are hiring a genomics post-doctoral researcher to join our team! Closing: 1st Jan, interviews: 13 Jan.. More info & application: www.birmingham.ac.uk/jobs Search JOB ID: 104642
birmingham.ac.uk
Jobs at the University of Birmingham - University of Birmingham
Search our latest jobs and find out what benefits are offered to our staff at the University of Birmingham.
054
Jorge Ferrer @jorge-ferrer.bsky.social · 17/12/2024
First lab photo in bluesky, hiking from Vilanova to Sitges (missing Vahid).
080
Reposted by Jorge Ferrer
Manuel Irimia @mirimiam.bsky.social · 05/12/2024
Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work! english.elpais.com/science-tech...
english.elpais.com
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders
1356
Reposted by Jorge Ferrer
Centre de Regulació Genòmica (CRG) @crg.eu · 05/12/2024
We have many fully-funded PhD positions open at our research labs here in Barcelona. If you'd like to find out more, we're hosting an online workshop on the 13th of December 2025 (3PM CET) to learn how to find the right lab and experts tips on how to prepare an outstanding application. Register now!
us02web.zoom.us
Welcome! You are invited to join a meeting: Envision Your Research Future – How to choose a lab for your PhD & CRG Opportunities. After registering, you will receive a confirmation email about joining...
Welcome! You are invited to join a meeting: Envision Your Research Future – How to choose a lab for your PhD & CRG Opportunities. After registering, you will receive a confirmation email about joining...
045
Jorge Ferrer @jorge-ferrer.bsky.social · 03/12/2024
www.cell.com/cell/fulltex...
cell.com
Long-term in vitro expansion of a human fetal pancreas stem cell that generates all three pancreatic cell lineages
Identification of an LGR5 as a marker for a tripotent stem/progenitor cell of the human fetal pancreas. Organoids derived from single LGR5+ cells are capable of long-term expansion in vitro and genera...
040
Reposted by Jorge Ferrer
James Briscoe @jamesbriscoe.bsky.social · 29/11/2024
Fascinating & unexpected from the Rodriguez lab on cell competition acting as a nutrient sensor Winner cells increase L-Proline uptake in losers, repressing their survival pathway (ISR) to kill them Explains old observations that starvation prevents competition www.biorxiv.org/content/10.1...
biorxiv.org
Sensing of extracellular L-Proline availability by the integrated stress response determines the outcome of cell competition.
Cell competition is a quality control acting from development to the adult that eliminates cells that are less-fit than their neighbours. How winner cells induce the elimination of losers during this ...
26224
Reposted by Jorge Ferrer
MRC Laboratory of Medical Sciences @mrc-lms.bsky.social · 25/11/2024
A new review entitled “Senescence as a therapeutic target in cancer and age-related diseases” from the Senescence group has been published in @natureportfolio.bsky.social 🥳 🧵: 1/12 www.nature.com/articles/s41...
nature.com
Senescence as a therapeutic target in cancer and age-related diseases - Nature Reviews Drug Discovery
Recent progress in understanding senescence has spurred interest in the development of approaches that target senescent cells. This Review assesses the current status of senotherapies, such as senolyt...
1115
Reposted by Jorge Ferrer
Heiko Lickert @heikolickert.bsky.social · 25/11/2024
Thrilled to share one of our biggest discoveries: “Inceptor binds to and directs insulin towards lysosomal degradation in beta cells”. doi.org/10.1038/s422... A tremendous collaborative effort led by JohannaSiehler, Sara Bilekova and other members of the Lickert lab @heikolickert.bsky.social
doi.org
Inceptor binds to and directs insulin towards lysosomal degradation in β cells - Nature Metabolism
The insulin inhibitory receptor (inceptor) is found to bind to insulin and to regulate insulin stores by directing proinsulin and insulin towards lysosomal degradation.
613053
Reposted by Jorge Ferrer
Centre de Regulació Genòmica (CRG) @crg.eu · 18/11/2024
Hello! We are the CRG in Barcelona. We are quite used to blue skies around here.
18214
Reposted by Jorge Ferrer
Christian Nefzger @nefzgerlab.bsky.social · 18/11/2024
Our recent study in Cell Metabolism provides compelling evidence that chromatin accessibility and transcription factor network remodeling in aging reflect the predictable degrading effects of a mechanism initially driving organismal maturation. Link: doi.org/10.1016/j.cmet.2024.06.006 Thread 🧵👇1/9
39924
Jorge Ferrer @jorge-ferrer.bsky.social · 23/11/2024
We are really looking forward to you joining in a few months. Exciting times!
140
Reposted by Jorge Ferrer
Irene Miguel-Aliaga @irenemiguel-aliaga.bsky.social · 23/11/2024
Job opportunity for a clinician scientist @ims-mrl.bsky.social www.jobs.cam.ac.uk/job/49273/
jobs.cam.ac.uk
Professorship of Endocrinology (Honorary Consultant) - Job Opportunities - University of Cambridge
Professorship of Endocrinology (Honorary Consultant) in the Department of Clinical Biochemistry at the University of Cambridge.
012
Jorge Ferrer @jorge-ferrer.bsky.social · 23/11/2024
This place feels like a breath of fresh air. I look forward to connecting with exciting science and anything else worth discussing
030