Sign in

Raquel Espin

@espinlab.bsky.social
574 followers 136 following 48 posts

Decoding blood development

PostsRepliesMedia
Reposted by Raquel Espin
Katherine W. Rogers @katwrog.bsky.social · 11/09/2026
Excited to share Will Anderson's publication describing his optogenetic FGF/ERK activator transgenic #zebrafish! Will demonstrated spatially localized FGF/ERK activation with 1 min light exposure at 1 dpf 👀 journals.biologists.com/bio/article/...
65312
Reposted by Raquel Espin
Zebrafish Rock! @zebrafishrock.bsky.social · 29/08/2026
For those keen to get involved ⬇️
021
Reposted by Raquel Espin
Zebrafish Disease Models Society (ZDMS) @zdmsociety.bsky.social · 24/08/2026
Happening on Wednesday this week ⬇️ There's still time to register for those that are interested in attending this FREE event: us06web.zoom.us/meeting/regi... 🐟👩‍🔬
us06web.zoom.us
Welcome! You are invited to join a meeting: ZDMS - Muscle & Cardiac RIG. After registering, you will receive a confirmation email about joining the meeting.
Welcome! You are invited to join a meeting: ZDMS - Muscle & Cardiac RIG. After registering, you will receive a confirmation email about joining the meeting.
022
Reposted by Raquel Espin
Zebrafish Rock! @zebrafishrock.bsky.social · 22/08/2026
Find out how RNA control your immune system! The Renshaw Lab (Sheffield) are hiring TWO PDRAs to study RNA-binding protein ELAVL1 in neutrophils using human cells, #zebrafish, multi-omics. Closes 26/8 Wet lab-based: www.jobs.ac.uk/job/DSK873/r... Bioinformatics-based: www.jobs.ac.uk/job/DSK931/r...
Neutrophil migration over time during inflammation. Credit to Catherine Loynes.
175
Reposted by Raquel Espin
@NicoliLab @nicolilab.bsky.social · 13/08/2026
What do we actually do in the Nicoli Lab? Here’s a glimpse into our science, our questions, and the people behind the work 🧬❤️🐟🩸 www.youtube.com/watch?v=CPmi...
youtube.com
The Endothelium, RNA, & Resilience - The Nicoli Lab at Yale School of Medicine
YouTube video by Yale Medicine
0145
Reposted by Raquel Espin
Jennifer Trowbridge @trowbridgelab.bsky.social · 01/08/2026
📢 BIG NEWS in ISEH's journal Experimental Hematology!!! 2 new article types specifically designed for research often difficult to publish: validated protocols, null results, phenotyping & high-value datasets. Plus fast-track review + a $650 incentive! 🔗 iseh.org/Publications...
iseh.org
ExpHem Journal
082
Reposted by Raquel Espin
Keisuke Ito @keisukeito-lab.bsky.social · 30/07/2026
On behalf of the Editorial Board of Experimental Hematology, we can’t share enough how excited we are about our new article types—Standards in Hematology and ExpHem Insights. A real chance to highlight best practices and key research—there’s no other venue in the field. Major relaunch!
033
Reposted by Raquel Espin
Maura McGrail @mcgraillab.bsky.social · 09/04/2025
#zebrafish New runx1-2A-creERT2 KI line now posted on zebrafishccr.org/runx1-2a-cre... Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
zebrafishccr.org
runx1-2A-creERT2 - Zebrafish Community Cre/lox Resource
KI Name runx1-2A-creERT2 Gene runx1 (ZFIN) ZFIN Gene Page runx1 family transcription factor 1 Lineage blood; HSCs Target Location exon 7 gRNA PAM GACGGCCTCTACAGACATGCTGG Genotype Tg(runx1-2A-creERT2; ...
1142
Reposted by Raquel Espin
Maura McGrail @mcgraillab.bsky.social · 01/04/2025
#zebrafish Our Zebrafish Community Cre/lox Resource is online!! zebrafishccr.org Check out what's available, imaging and information, and make a request. We're so very grateful to the NIH ORIP for supporting this work! Huge thanks to Parnal Joshi from Iddo Friedberg lab for creating the website!
zebrafishccr.org
Zebrafish Community Cre/lox Resource - Zebrafish Community Cre/lox Resource
Bringing you precision Cre/CreERT2 and floxed lines driven by GeneWeld CRISPR targeted integration. Mission Our mission is to provide the Zebrafish community with Cre resources that open new areas of ...
0196
Raquel Espin @espinlab.bsky.social · 15/07/2026
Amazing new #runx1 knock-in lineage-tracing tool for the #zebrafish #hematopoieitic community from @mcgraillab.bsky.social, led by talented Preston 🐟🧬✂️ Huge thanks for developing another incredible resource and for the opportunity to help 🩸🧫 Excited to see all the discoveries this tool will enable!
041
Raquel Espin @espinlab.bsky.social · 12/06/2026
The latest paper from the Espin lab is out! 🍾🎉 www.cell.com/cell-reports...
cell.com
Synergistic cooperation between progranulin and Jak2/Stat3 signaling determines definitive myeloid cell fate
McCune et al. demonstrate that progranulin enforces myeloid fate by regulating JAK2/STAT3 and uncover functional differences between two embryonically derived macrophage populations. These findings pr...
2103
Reposted by Raquel Espin
Zebrafish Rock! @zebrafishrock.bsky.social · 04/06/2026
Happening later today 🚨 There's still time to register for the Skeletal Disease RIG Meet up: us06web.zoom.us/meeting/regi...
us06web.zoom.us
Welcome! You are invited to join a meeting: ZDMS RIG - Skeletal Disease. After registering, you will receive a confirmation email about joining the meeting.
Welcome! You are invited to join a meeting: ZDMS RIG - Skeletal Disease. After registering, you will receive a confirmation email about joining the meeting.
021
Raquel Espin @espinlab.bsky.social · 03/06/2026
Only a couple of hours left to join us for the free ZDMS Infection&Inflammation RIG seminar! We have a great line up of speakers! Register here! 👇
000
Reposted by Raquel Espin
Zebrafish Disease Models Society (ZDMS) @zdmsociety.bsky.social · 01/06/2026
On the #ZDMS itinerary for this week: Infection & Inflammation RIG Meet Up on Wednesday (3rd) 🦠🐟 and Skeletal Disease RIG Meet Up on Thursday (4th) 🦴🐟 Both webinars start at 7AM PST | 10AM ET | 3PM BST | 4PM CEST | 7:30 IST. More details about these FREE events & how to register below ⬇️
Banner for 2026 RIG MEET UPS sponsored by the Zebrafish Disease Models Society (ZDMS)
232
Reposted by Raquel Espin
Jennifer Trowbridge @trowbridgelab.bsky.social · 21/05/2026
Our Stem Cells & Developmental Biology program is live! We've built something rare: an integrated community of basic & translational scientists, innovative technologies & humanized models — all aimed at improving human health. @jax.org 🔗 go.jax.org/stem-cell-research #JAXresearch #JAXstemcellsdev
go.jax.org
Stem Cells & Developmental Biology
At JAX, we investigate how genetic and epigenetic programs govern stem cell fate, tissue growth and patterning, and regeneration—and how these processes can be restored in disease—by integrating devel...
0145
Reposted by Raquel Espin
Zebrafish Disease Models Society (ZDMS) @zdmsociety.bsky.social · 18/05/2026
Join us for a FREE webinar as part of our 2026 RIG Meet Ups series ✨ Next up: Hematology with 3 superb experts on Wednesday (20th)🩸🐟 While free for the public, you must register for access ➡️ us06web.zoom.us/meeting/regi.... For a full list of webinars, check out: www.zdmsociety.org/2026-zdms-ri...
Poster for ZDMS Hematology Research Interest Group (RIG) Meet up on 20 May 2026 at 10-11:30 AM ET (3-4:30PM GMT). It is free and will take place online. There is an image of a transgenic zebrafish that has its blood vessels marked.
053
Reposted by Raquel Espin
Sofia de Oliveira, Ph.D. @sdeoliveira.bsky.social · 19/05/2026
🧪📣Join us May 27 at 1 PM ET for Dr. Andres Hidalgo, Yale Immunology, presenting “Understanding Neutrophils.” Free registration for all. Come for great leukocyte biology and discussion. slb.memberclicks.net/building-bri...
slb.memberclicks.net
Building Bridges in Leukocyte Biology Webinar Series
064
Reposted by Raquel Espin
Zebrafish Disease Models Society (ZDMS) @zdmsociety.bsky.social · 13/05/2026
Thinking of going to #ZDM19? Don't let the cost of travel deter you! ZDMS members are eligible for travel awards 💸 You can apply for these when you submit an abstract: www.zdmsociety.org/zdm19-abstra... Members also get discounted registration fees! To sign up: www.zdmsociety.org/membership-s... 🐟
Logo for ZDM19 in Oxford, UK 2026. There are two silhouettes of fish swimming (one in blue and one in grey).
043
Reposted by Raquel Espin
Katherine W. Rogers @katwrog.bsky.social · 13/05/2026
New preprint from my lab! Will Anderson developed a transgenic #zebrafish ubiquitously expressing an optogenetic FGF/ERK activator. We're having a lot of fun with it and think you will too! www.biorxiv.org/content/10.6...
biorxiv.org
03611
Reposted by Raquel Espin
Zebrafish Disease Models Society (ZDMS) @zdmsociety.bsky.social · 01/05/2026
The first webinar (on Cancer Technology) from our 2026 RIG Meet Ups series starts this upcoming Monday (May 4th) at 7AM PST | 10AM ET | 3PM BST | 4PM CEST | 5PM IDT | 7:30 IST. To sign-up for the FREE event, you must register here: us06web.zoom.us/meeting/regi... #ZDMS #zebrafish #RIGMeetups2026 🐟
Banner for 2026 RIG Meet Ups by the Zebrafish Disease Models Society.
033
Raquel Espin @espinlab.bsky.social · 25/04/2026
Thank you to past&present members of the Espinlab, colleagues and chair of #GDCB and #ISU, letter writers, collaborators, and to my husband! I got promoted to Associate Professor this week, and that wouldn’t have happened without the great support from everyone! 🙏😊
5212
Reposted by Raquel Espin
Katherine King MD PhD @thekinglab.bsky.social · 17/04/2026
Thanks @isehsociety.bsky.social for highlighting our recent paper relating infection history to the emergence of clonal hematopoiesis! Super collab with Elizabeth Platz and the ARIC longitudinal study! @bcmhouston.bsky.social
092
Reposted by Raquel Espin
ISEH - International Society for Experimental Hematology @isehsociety.bsky.social · 10/04/2026
Don't forget to register to attend next week's Mini Symposium! With featured presentations from @beth_psaila, Simón Méndez-Ferrer, PhD, @JianXuLab, and short talks from selected abstracts, you won't want to miss this event. View program & register👉️ iseh.org/Webinars-Eve...
022
Reposted by Raquel Espin
Morphology Visuals @morphologyvisuals.bsky.social · 01/04/2026
Just delivered a Data Visualization for Publishing talk at #EHAReCon2026! At the same time: ✈️ First trip to Finland 🏢 Learned about Alvar Aalto’s incredible architectural design 🌱 Discovered new mosses 🤝🏻 Got to see friends, and meet new ones 🎨 Sketch time! What a great week!
131
Reposted by Raquel Espin
ISEH - International Society for Experimental Hematology @isehsociety.bsky.social · 05/03/2026
Register to attend the 2026 Mini Symposium! With featured presentations from Bethan Psaila, MBBS, PhD, Simón Méndez-Ferrer, PhD, Jian Xu, PhD, and selected abstracts, you won't want to miss this event! Register👉️ iseh.org/Webinars-Eve...
022
Reposted by Raquel Espin
Pauli Group (posts by Andi Pauli) @pauligroup.bsky.social · 11/02/2026
Switching fields or wanting to become an expert in #zebrafish research? The @mblscience.bsky.social 2026 Zebrafish Development & Genetics course offers a fantastic opportunity to learn from leaders in the field! Application deadline: March 2 Please spread the word! www.mbl.edu/education/ad...
02830
Reposted by Raquel Espin
ISEH - International Society for Experimental Hematology @isehsociety.bsky.social · 12/02/2026
Submit an abstract for the 2026 Mini Symposium by 28 February! Abstract submitters will have a chance to earn a symposium short talk, travel grant and #ISEH2026 🏙️ speaking slot. 👉️ iseh.org/Webinars-Eve...
032
Reposted by Raquel Espin
Zebrafish Rock! @zebrafishrock.bsky.social · 05/02/2026
Keynote speakers have been confirmed for #ZDM19 in Oxford! Featuring @tristanorth.bsky.social (@bostonchildrens.bsky.social)& KJ Patel (@imm.ox.ac.uk) 🤩 Stay up-to-date on the conference by visiting www.zdmsociety.org/zdm19 & following @zdmsociety.bsky.social (They will eventually post things!) 🧪
ZDM19 Conference Banner. Two silhouettes of fish in grey and blue swimming next to the text 'ZDM19 Oxford UK 2026'
033
Reposted by Raquel Espin
Shannon McKinney-Freeman @smckinneyfreeman.bsky.social · 17/01/2026
Have you ever wondered about Pig HSCs? Today is your lucky day! Check out this excellent work from @ganuzalab.bsky.social. Well done! Pig and human adult hematopoietic stem and progenitor cells are overall transcriptionally similar. www.exphem.org/article/S030... @isehsociety.bsky.social
exphem.org
Pig and human adult hematopoietic stem and progenitor cells are overall transcriptionally similar
Allotransplantation provides a lifesaving treatment to hundreds of thousands of patients worldwide every year, including among others heart, kidney, liver and bone marrow (BM) transplants [1,2]. Yet, ...
154
Reposted by Raquel Espin
Sofia de Oliveira, Ph.D. @sdeoliveira.bsky.social · 12/01/2026
📣Building Bridges in Leukocyte Biology #BBinLB webinar series hosted by the @leukocytebiology.bsky.social Next speaker: @oehlerslab.org "Differential subversion of host immune signalling by tuberculous and non-tuberculous mycobacteria" 📅 Jan 28 at 9 am EST -register free link below #Zebrafish
1115
Reposted by Raquel Espin
Ganuza Lab @ganuzalab.bsky.social · 21/12/2025
Check out our collaborative Review Article with Dr Momoko Yoshimoto on: HSC-independent and -dependent hematopoiesis: new insights and lineage tracing methods. - Experimental Hematology www.exphem.org/article/S030... @isehsociety.bsky.social @qmbci.bsky.social
exphem.org
HSC-independent and -dependent hematopoiesis: new insights and lineage tracing methods.
Hematopoietic cells are mesodermal in origin and emerge through a highly regulated process known as endothelial-to-hematopoietic transition (EHT), which yields various hematopoietic progenitors 1,2 In...
063
Reposted by Raquel Espin
ISEH - International Society for Experimental Hematology @isehsociety.bsky.social · 18/12/2025
Submit your research for a chance to give a short talk at the 2026 Mini Symposium taking place 16 April. The presenter of the best short talk, as voted by attendees, will earn a speaking spot at #ISEH2026 🏙️ and will be awarded a Travel Grant! Submit by 28 February to be considered👉
docs.google.com
2026 Mini Symposium Abstract Submission
April 16th, 2026 - 3:00 - 6:00pm (US CDT) Online symposium Contact: info@iseh.org The 3rd Mini Symposium organized by the Junior Faculty Committee of the International Society for Experimental…
022
Reposted by Raquel Espin
Ganuza Lab @ganuzalab.bsky.social · 14/12/2025
Check our new article: Pig and human adult hematopoietic stem and progenitor cells are overall transcriptionally similar We must understand pig hematopoiesis to enable bone marrow xenotransplantation. @qmbci.bsky.social Emma Bailey @foteinikal.bsky.social www.exphem.org/article/S030...
exphem.org
Pig and human adult hematopoietic stem and progenitor cells are overall transcriptionally similar
Allotransplantation provides a lifesaving treatment to hundreds of thousands of patients worldwide every year, including among others heart, kidney, liver and bone marrow transplants1,2. Yet, thousand...
122
Reposted by Raquel Espin
Wittamer Lab @valeriewittamer.bsky.social · 13/12/2025
🚨 Paper alert! The final version of our latest manuscript is published. We are excited to share this new resource for the zebrafish community and beyond: doi.org/10.7554/eLif... Congratulations to all authors! 🥳
doi.org
A single-cell transcriptomic atlas reveals resident dendritic-like cells in the zebrafish brain parenchyma
The zebrafish brain combines a conserved heterogeneity of immune cells with a unique dendritic cell-like population.
4237
Reposted by Raquel Espin
Joe Italiano @megaman55.bsky.social · 20/11/2025
Join us to pursue cutting-edge research at the interface of megakaryocyte biology and translational medicine. We have NIH-funded postdoc positions available to investigate platelet production and the broader functions of megakaryocytes. I’ll be attending ASH and would be happy to connect.
063
Reposted by Raquel Espin
Society for Developmental Biology @socdevbio.bsky.social · 13/11/2025
Save the date! @isscr.org, @alleninstitute.org & @socdevbio.bsky.social are collaborating to present a 3-day scientific symposium led by early-career scientists. The Stem Cell & Developmental Biology Early Career Symposium will be held September 23-25, 2026 in Seattle, WA. Learn more: bit.ly/4p98dkv
Stem Cell & Developmental Biology Early Career Symposium
September 23-25, 2026
Seattle, Washington, USA
Planning Committee: Alessandro Bertero, Ken Cho, Gideon Dunster, Whitney Edwards, Evan Graham, Valentina Greco, Leigh Harris, Serge Parent, Helen Willsey
Allen Institute logo; International Society for Stem Cell Research logo; Society for Developmental Biology logo
02418
Raquel Espin @espinlab.bsky.social · 12/11/2025
Stunning Northern Lights tonight from our house
040
Reposted by Raquel Espin
ISEH - International Society for Experimental Hematology @isehsociety.bsky.social · 27/10/2025
This year at #ISEH2025 we celebrated the 2025 Donald Metcalf Awardee, Constanze Bonifer. Who's next? The 13 November deadline to submit a Scientific Award nomination is approaching! Check out iseh.org/About/Awards for more details.
021
Raquel Espin @espinlab.bsky.social · 25/10/2025
Sometimes we forget that it is important to have FUN, even in challenging times. Grateful to have an amazing team representing 6 countries 🇬🇭 🇪🇸 🇱🇰 🇧🇩 🇻🇳 🇺🇸 pushing research, but also enjoying our Espin-Campbell lab barbecue!
040
Reposted by Raquel Espin
Owen Tamplin @otamplin.bsky.social · 20/10/2025
Check out our new paper! GABA produced by multiple bone marrow cell types regulates hematopoietic stem and progenitor cells: Stem Cell Reports www.cell.com/stem-cell-re...
cell.com
GABA produced by multiple bone marrow cell types regulates hematopoietic stem and progenitor cells
Tamplin and colleagues functionally test production of GABA metabolite in the bone marrow microenvironment as a regulator of hematopoietic stem and progenitor cells. Conditional deletion of GAD enzyme...
192
Reposted by Raquel Espin
Keystone Symposia @keystonesymposia.bsky.social · 25/09/2025
Abstracts & scholarship apps for #KSHemato26 are due Oct 29—but @beaudinlab.bsky.social explains why you should submit early! 🎥 youtu.be/FcO6D87EC_Q Join us Feb 23–26, 2026 in Keystone, CO 👉 keysym.us/KSHemato26 @bloodgenes.bsky.social #hematopoiesis #bonemarrow #hematopoieticstemcells
youtu.be
KSQA: Dr. Anna Beaudin (Hematopoiesis)
YouTube video by KeystoneSymposia
083
Reposted by Raquel Espin
Keisuke Ito @keisukeito-lab.bsky.social · 25/09/2025
Are you a PI who just set up your lab or wants a more efficient daily flow? @isehsociety.bsky.social Junior Faculty Committee (and more) share in #ExpHem to help you build a transparent and functional lab culture. See how a Lab Handbook can benefit you. @nickvangastel.bsky.social bit.ly/3KBFvcQ
0104
Raquel Espin @espinlab.bsky.social · 19/09/2025
Congratulations to the Doulatov lab! 🎉🎉🎉 Great story and scientific resource. Thank you for the opportunity to participate in this study
010
Reposted by Raquel Espin
Sarada Ketharnathan @saradakethar.bsky.social · 13/09/2025
Stoked to have Maura McGrail @mcgraillab.bsky.social, Iowa State University, at #ZDM18. Don’t miss her talk “Modeling neural development and disease with Cre/lox cell type-specific knockout” in the Technological Advances and Drug Discovery session on Oct 15th at 9:00 AM. #ZDMSociety #zdmsECI
052
Raquel Espin @espinlab.bsky.social · 11/09/2025
One of my favorite societies. Great #science, amazing #hematopoietic community and resources. Check it out!
040
Reposted by Raquel Espin
Keisuke Ito @keisukeito-lab.bsky.social · 10/09/2025
Had a wonderful visit to Iowa State Univ. for the GDCB seminar! Huge thanks to Raquel @espinlab.bsky.social & Clyde @clydecampbell-lab.bsky.social for the warm hosting. Loved exploring stem cell metabolism collaborations with ISU faculty & trainees—plus Iowa’s sweet corn! @einsteinmededu.bsky.social
182
Raquel Espin @espinlab.bsky.social · 05/09/2025
We are very excited for your visit to #ISU, Keisuke!
030
Reposted by Raquel Espin
Zebrafish Information Network (ZFIN) @zfinmod.bsky.social · 29/08/2025
[Job] Research Intern for Cell and Regenerative Biology, Tamplin Lab, University of Wisconsin, Madison, WI #zebrafish
zfin.atlassian.net
Research Intern for Cell and Regenerative Biology, Tamplin Lab, University of Wisconsin, Madison, WI - Jobs - Confluence
053
Reposted by Raquel Espin
ISEH - International Society for Experimental Hematology @isehsociety.bsky.social · 24/08/2025
@eirinipapapetrou.bsky.social from the Icahn School of Medicine at Mount Sinai is looking most forward to the iPSC-derived Hematopoiesis Symposium that is being organized the day before #ISEH2025 🏯 begins. Learn more about this event and register! sites.google.com/view/2025ips...
Q: What scientific session at #ISEH2025 are you looking forward to the most?  
A: “I am mostly looking forward to the iPSC-derived Hematopoiesis Symposium – a half-day symposium taking place on Wednesday afternoon that I co-organize. This symposium is now on its 4th year and brings together researchers from the fields of developmental hematopoiesis, disease modeling and cell therapies who share a common interest in using human pluripotent stem cell models.”
031
Raquel Espin @espinlab.bsky.social · 19/08/2025
Looking forward to this #ISEH webinar by two amazing women in the field
042