Sign in

Maura McGrail

@mcgraillab.bsky.social
225 followers 264 following 11 posts

Zebrafish developmental geneticist, genome engineer, brain development and disease

PostsRepliesMedia
Maura McGrail @mcgraillab.bsky.social · 30/04/2025
#zebrafish Does anyone stateside have a ubi:mRFP-CAAX line? Thanks!
222
Reposted by Maura McGrail
Zebrafish Rock! @zebrafishrock.bsky.social · 08/04/2025
“We report a novel imaging technique using a recently developed clearing reagent called LUCID that makes it possible to capture the complete cellular-resolution 3D structures of larval and juvenile zebrafish.” New work from Weinstein Lab at NIH 🐟
Figure 1 taken from preprint from Weinstein Lab. A,C brightfield image of an zebrafish larva. B,D LUCID cleared zebrafish larva. E, F images of the brain with and without LUCID clearing.
05917
Maura McGrail @mcgraillab.bsky.social · 09/04/2025
#zebrafish New runx1-2A-creERT2 KI line now posted on zebrafishccr.org/runx1-2a-cre... Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
zebrafishccr.org
runx1-2A-creERT2 - Zebrafish Community Cre/lox Resource
KI Name runx1-2A-creERT2 Gene runx1 (ZFIN) ZFIN Gene Page runx1 family transcription factor 1 Lineage blood; HSCs Target Location exon 7 gRNA PAM GACGGCCTCTACAGACATGCTGG Genotype Tg(runx1-2A-creERT2; ...
1142
Reposted by Maura McGrail
Jenny Montooth @montoj.bsky.social · 02/04/2025
So long, NIH. The place I grew up in and discovered my passion for science communication. I found a true calling to help take innovative genomics research and make it accessible, interesting and fun for wider audiences. I'm so devastated that my whole team got laid off today.
1245597
Maura McGrail @mcgraillab.bsky.social · 01/04/2025
#zebrafish Our Zebrafish Community Cre/lox Resource is online!! zebrafishccr.org Check out what's available, imaging and information, and make a request. We're so very grateful to the NIH ORIP for supporting this work! Huge thanks to Parnal Joshi from Iddo Friedberg lab for creating the website!
zebrafishccr.org
Zebrafish Community Cre/lox Resource - Zebrafish Community Cre/lox Resource
Bringing you precision Cre/CreERT2 and floxed lines driven by GeneWeld CRISPR targeted integration. Mission Our mission is to provide the Zebrafish community with Cre resources that open new areas of ...
0196
Maura McGrail @mcgraillab.bsky.social · 29/03/2025
Zebrafish Community Cre/lox Resource website (ZebrafishCCR) will be online soon!
0309
Maura McGrail @mcgraillab.bsky.social · 29/03/2025
Our DyDy zebrafish hand2-cre and hand2-creERT2 KI paper is online! anatomypubs.onlinelibrary.wiley.com/share/IPCM9K... Beautiful work Zhitao Ming and Dr. Fang Liu, fantastic collaborators Christian Mosimann, Chunyue Yin and Saulius Sumanas. Ready to ship - email requests to mmcgrail@iastate.edu
anatomypubs.onlinelibrary.wiley.com
Lineage labeling with zebrafish hand2 Cre and CreERT2 recombinase CRISPR knock‐ins
You have to enable JavaScript in your browser's settings in order to use the eReader.
0112