Welcome! You are invited to join a meeting: ZDMS - Muscle & Cardiac RIG. After registering, you will receive a confirmation email about joining the meeting.

YouTube video by Yale Medicine

KI Name runx1-2A-creERT2 Gene runx1 (ZFIN) ZFIN Gene Page runx1 family transcription factor 1 Lineage blood; HSCs Target Location exon 7 gRNA PAM GACGGCCTCTACAGACATGCTGG Genotype Tg(runx1-2A-creERT2; ...

Bringing you precision Cre/CreERT2 and floxed lines driven by GeneWeld CRISPR targeted integration. Mission Our mission is to provide the Zebrafish community with Cre resources that open new areas of ...

McCune et al. demonstrate that progranulin enforces myeloid fate by regulating JAK2/STAT3 and uncover functional differences between two embryonically derived macrophage populations. These findings pr...

McCune et al. demonstrate that progranulin enforces myeloid fate by regulating JAK2/STAT3 and uncover functional differences between two embryonically derived macrophage populations. These findings pr...

McCune et al. demonstrate that progranulin enforces myeloid fate by regulating JAK2/STAT3 and uncover functional differences between two embryonically derived macrophage populations. These findings pr...

Shifting sites of blood cell production during development is common across widely divergent phyla. In zebrafish, like other vertebrates, hematopoietic development has been roughly divided into two wa...

Welcome! You are invited to join a meeting: ZDMS RIG - Skeletal Disease. After registering, you will receive a confirmation email about joining the meeting.

At JAX, we investigate how genetic and epigenetic programs govern stem cell fate, tissue growth and patterning, and regeneration—and how these processes can be restored in disease—by integrating devel...

Allotransplantation provides a lifesaving treatment to hundreds of thousands of patients worldwide every year, including among others heart, kidney, liver and bone marrow (BM) transplants [1,2]. Yet, ...