Reposted by Pulpfiction Books42four @424.bsky.social · 4hCool how conservatives just outright lie and everyone is ¯\_(ツ)_/¯. 292
Reposted by Pulpfiction BooksIndrapramit Das @indrapramitdas.bsky.social · 11hAs someone who's demographically 'Hindu' and lives in India, a defacto Hindu ethnostate for a decade now, witnessing across my life and every day the horrors that ethnonationalism perpetrates, the idea that ethnonationalist movements are racist poison isn't remotely controversial. 29928
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026EFFORTLESS COMMERCE 😇 - totes are getting printed right now, 2 weeks or less & we'll deliver. Thanks! 010
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026You can do the whole thing on our fancy new website (pfbvan.ca) or drop by!pfbvan.caPulpfiction Books 120
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026No "Stars" in house @ either PFB. Def orderable - $25.99 + GST - but likely 2 weeks away... 110
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026Will have a snoop & drop a line by 11; just got in! 110
Reposted by Pulpfiction BooksRX1F @rx1f.com · 04/10/2026curious how the follow-up goes "father God, we understand that you looked upon our party and campaign and your will was that we not be elected. we assume that you will change your mind eventually" 072
Reposted by Pulpfiction BooksMichael Ledger-Lomas @michaelledgerlomas.bsky.social · 04/10/2026The Epistle to the Vancouverites 792
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026Earthquaka. EARTHquaka. Whole lotta shakin' goin' on. 250
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026Have I got news for you. Signed, Jurassic Ridge v. my knees. 020
Reposted by Pulpfiction BooksMichael Ledger-Lomas @michaelledgerlomas.bsky.social · 03/10/2026A wonderful way to mark the day that Sim appointed as Chip Wilson Day. 1143
Reposted by Pulpfiction BooksAndrea Woo @andreawoo.bsky.social · 03/10/2026Hoo boy. A deep dive on the cross-border effort to sway Alberta’s secession vote, from @carrietait.bsky.social, Nathan VanderKlippe and Grant Robertson www.theglobeandmail.com/canada/artic... 23511
Reposted by Pulpfiction BooksCatherine Winters @catherinewinters.com · 03/10/2026Me, writing a novel set on a decrepit secondhand cargo ship: Haha fuck yeah!!! Yes!! Me checking my feed: Well this fucking sucks. What the fuck." 2102
Pulpfiction Books @pfbvan.bsky.social · 02/10/2026"I’ve rarely read scenes so terrifying, achieved with a kind of stutter-step language, words that intensify and recede with such incantatory power. These passages seem unparalleled in literature and somehow bypass the brain to jolt the nervous system directly--"nytimes.comA Haunting Masterwork From a Writer Who Is Reinventing Fantasy“The Rouse,” by China Miéville, is a decade-spanning epic about a secret military unit trying to channel supernatural forces. 28111
Reposted by Pulpfiction BooksJen St. Denis @jenstden.bsky.social · 02/10/2026Remembering Vancouver music writer Andrea Warner, who died this week of cancer at age 47 This is a beautiful remembrance that includes many links to Andrea's work. www.cbc.ca/music/andrea...cbc.caSaying goodbye to Andrea Warner | CBC MusicWe lost one of the very best on Sept. 27. 26017
Reposted by Pulpfiction BooksDr. Drew Brayshaw 🌊🪨 @drewbrayshaw.bsky.social · 02/10/2026our pet sitter sent us this pic of ms. beans and yes, 12/10 no notes you have captured the soul essence of my cat 2272
Reposted by Pulpfiction BooksCoach Finstock @coachfinstock.bsky.social · 01/10/2026The reason they want more people to adopt chatbots is because that could theoretically create a new revenue stream by eliminating the need for marketing or advertising and just taking cash from brands/parties/etc to change what the chatbot tells the user. 638057
Reposted by Pulpfiction BooksCoach Finstock @coachfinstock.bsky.social · 01/10/2026Dark thread. Since we watched Musk literally push a "protect the Boers" button in real time with Grok, we now know people or companies could theoretically pay their way into putting a thumb on the scale for Grok/Claude/ChatGPT. This is why the AI stans want you to believe it's thinking 15878240
Pulpfiction Books @pfbvan.bsky.social · 01/10/2026Receipts: National Day for Truth & Reconciliation profits generated $3100 CDN, divided equally, just now, between the Indian Residential School Survivors Society; Urban Native Youth Alliance; Vancouver Aboriginal Child & Family Services Society; and Native Education College. A good start. 0221
Reposted by Pulpfiction BooksElephant Mastodon @emath.bsky.social · 01/10/2026I just want to hear an Animorph tell me I'm a good boy. 082
Reposted by Pulpfiction BooksMichelle Cyca @michellecyca.com · 30/09/2026recommended reading today — Aaron Hemens’ interview with Phyllis Webstad, published two years ago on @indiginews.bsky.social. Webstad is not even mentioned on the federal government’s webpage for NDTR/Orange Shirt Day indiginews.com/news/orange-...indiginews.comOrange Shirt Day’s founder fears Sept. 30 is being co-opted from residential ‘school’ survivors‘I don’t want Orange Shirt Day to be forgotten — it was started by a survivor,’ says Phyllis Webstad, whose 11-year-old event now coincides with National Day for Truth and Reconciliation 15034
Reposted by Pulpfiction BooksAlbert Pinto @70sbachchan.bsky.social · 30/09/2026"Meta is using its A.I. data centers to exploit a lucrative tax break intended to support research and experimentation, according to an exclusive report by The New York Times. The company’s own accountants recognize that the strategy is on shaky legal ground. " www.nytimes.com/2026/09/30/t... 34213
Pulpfiction Books @pfbvan.bsky.social · 30/09/2026National Day for Truth & Reconciliation. Both PFB branches open. As always on this day, all profits from today's sales will be donated to a variety of local Indigenous-led groups. Receipts here & on our IG no later than October 7th. 0256
Reposted by Pulpfiction BooksVajra Chandrasekera @vajra.me · 30/09/2026My third novel, HERO COME HOME, officially has a cover! Preorderable from the usual places us.macmillan.com/books/978125... 56586199
Reposted by Pulpfiction BooksHypervisible @hypervisible.blacksky.app · 30/09/2026Eugenics 🤝 ai www.nytimes.com/2026/09/29/h... 1231779552
Reposted by Pulpfiction BooksHypervisible @hypervisible.blacksky.app · 29/09/2026So wild to me that the entire economy is propped up by companies who think living your best life is being a middle manager to a collection of bots. 3596124
Reposted by Pulpfiction BooksHypervisible @hypervisible.blacksky.app · 29/09/2026“What if we released malware represented in the form of a cute avatar” is an actual business plan now.engadget.comDots are OpenAI's new personal agents and soon you'll be able to control several of them - EngadgetSure, seems safe. 621184384
Reposted by Pulpfiction BooksChristina Shah @christinashah.bsky.social · 29/09/2026Living East Van, Writing East Van: A Literary Panel. Join me at the VPL for a lively reading and conversation with @normannawrocki.bsky.social, Evelyn Lau(!), and Nick Marino Oct 24th, 2:30 pm! 📕 Register here: vpl.bibliocommons.com/events/6a906... #poetry #eastvan #hastings-sunrisevpl.bibliocommons.comLiving East Van, Writing East Van: A Literary PanelWhat does it mean to be an East Van writer? For almost 150 years, East Vancouver has been the predominant home for Vancouver’s immigrant and working-class communities. More than a geographic location... 1164
Reposted by Pulpfiction BooksAndrea Woo @andreawoo.bsky.social · 28/09/2026Statement from Superintendent Jeff Pelley, officer in charge at Kamloops and Tk’emlúps Rural RCMP, on apparent Second Sons white nationalist gathering on Tk'emlúps te Secwépemc reserve Sunday (Sunday statement from Chief Kúkwpi7 Rosanne Casimir: tinyurl.com/2wbfxay5) 1168
Reposted by Pulpfiction BooksJ. Caleb Mozzocco @jcaleb.bsky.social · 28/09/2026Okay, maybe I'm being a bit facetious with the WATCHMEN comparison. But I've been thinking about Marvel "graphic novels" vs. DC ones, and I have a hard time thinking of any that meet this criteria I lay out in the post (especially the "in print" part): 19546
Reposted by Pulpfiction Bookscompliancedivision.bsky.social @compliancedivision.bsky.social · 28/09/2026Mysterious Brake Failure Astounds Investigators _________________________ Mayor to Award Key to City _________________________ Cleanup Volunteers Sought 111
Reposted by Pulpfiction BooksLaird Barron @lairdbarron.bsky.social · 28/09/2026A country that has to remind you to love it aint no country at all 35613
Reposted by Pulpfiction BooksDoctor Murder, M.D. ☮️🇵🇸 @rottenplanet.bsky.social · 28/09/2026Seeing this basement Nazi mindrot popping up here utterly disgusts me. 061
Pulpfiction Books @pfbvan.bsky.social · 25/09/2026"I’ve come to believe that the natural world is the greatest teacher of all, and that listening in silence to the universe around you is perhaps the most productive way of learning. So often people are afraid of their own thoughts, resorting to drowning them out with constant noise and distraction." 030
Reposted by Pulpfiction BooksDr. Drew Brayshaw 🌊🪨 @drewbrayshaw.bsky.social · 24/09/2026reading feline DNA and the sequence is just TAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACAT 152
Reposted by Pulpfiction BooksPaperback Paradise @paperbackparadise.bsky.social · 24/09/2026 253018860
Reposted by Pulpfiction BooksJack Murphy @jackmurphyrgr.bsky.social · 23/09/2026Why is it that conservatives are scared shitless of the people that they wish would fuck them in a motel room? You don't have to be Sigmund fucking Freud to figure out what's going on here. 810215
Reposted by Pulpfiction BooksKarlo Yeager Rodríguez @kjy1066.bsky.social · 23/09/2026The Vanished Birds by Simon Jimenez - amazing post-colonial space opera that released to seeming silence 2255
Reposted by Pulpfiction BooksLeah Sottile @leahsottile.bsky.social · 23/09/2026Happy Crone pub day to my pal @keithrosson.bsky.social! If you aren’t reading Keith, what are you even doing? 0171
Reposted by Pulpfiction BooksNicholas Grossman @nicholasgrossman.bsky.social · 22/09/2026A university doing a special Chris Rufo program, expecting success under the belief there’s widespread public craving for ideological anti-woke “education” to counter all the “Marxism,” then when it turns out virtually no students are interested trying to make it mandatory, didn’t work out? Huh. 1336398
Reposted by Pulpfiction BooksMichael Ledger-Lomas @michaelledgerlomas.bsky.social · 22/09/2026Meet your TEAM candidates 2202
Reposted by Pulpfiction BooksStanley Q Woodvine @sqwabb.bsky.social · 21/09/2026At counter in #Vancouver South Granville McD's. Someone played with stick-on letters of the "Mobile Order Pick Up" sign. Staff noticed but seemed powerless in the face of such sophisticated vandalism. Did my best to fix it but "R" is gone - pehaps eaten while someone waited for their real order. 181
Pulpfiction Books @pfbvan.bsky.social · 21/09/2026www.westernstandard.news/bc/exclusive...westernstandard.newsEXCLUSIVE: Caucus faction tells Findlay to resign Saturday night or husband tape dropsPENTICTON — Elements of the Conservative Party of BC caucus have told leader Kerry-Lynne Findlay to resign Saturday evening, two sources said, and have threatened to release a recording of her husband... 100
Pulpfiction Books @pfbvan.bsky.social · 21/09/2026@duckdeux.bsky.social & I recently ate here. Strip-mall ambiance; attentive & thoughtful service; spice levels ranging from mainstream to shoulda-thoroughly-reconsidered. Momos a dozen ways, Nepali specialties, & some Indo-Chinese mashups. Highly recommended!momohut.caMomo Hut — Best Momo in VancouverExperience Nepal, one bite at a time. Authentic Nepalese cuisine on Fraser Street since 2006. 0210