Sign in

Pulpfiction Books

@pfbvan.bsky.social
10K followers 307 following 1.7K posts

YVR's legendary independent bookstore. Est. 6/00. 'The pessimism of the intellect, the optimism of the will.' (Gramsci). 2026 Living Wage employer.

PostsRepliesMedia
Reposted by Pulpfiction Books
42four @424.bsky.social · 4h
Cool how conservatives just outright lie and everyone is ¯\_(ツ)_/¯.
A flyer from ABC Vancouver falsely representing other candidates views on drug consumption.
292
Pulpfiction Books @pfbvan.bsky.social · 7h
012720
Reposted by Pulpfiction Books
Indrapramit Das @indrapramitdas.bsky.social · 11h
As someone who's demographically 'Hindu' and lives in India, a defacto Hindu ethnostate for a decade now, witnessing across my life and every day the horrors that ethnonationalism perpetrates, the idea that ethnonationalist movements are racist poison isn't remotely controversial.
29928
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026
EFFORTLESS COMMERCE 😇 - totes are getting printed right now, 2 weeks or less & we'll deliver. Thanks!
010
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026
You can do the whole thing on our fancy new website (pfbvan.ca) or drop by!
pfbvan.ca
Pulpfiction Books
120
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026
No "Stars" in house @ either PFB. Def orderable - $25.99 + GST - but likely 2 weeks away...
110
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026
Will have a snoop & drop a line by 11; just got in!
110
Reposted by Pulpfiction Books
RX1F @rx1f.com · 04/10/2026
curious how the follow-up goes "father God, we understand that you looked upon our party and campaign and your will was that we not be elected. we assume that you will change your mind eventually"
072
Reposted by Pulpfiction Books
Michael Ledger-Lomas @michaelledgerlomas.bsky.social · 04/10/2026
The Epistle to the Vancouverites
792
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026
Earthquaka. EARTHquaka. Whole lotta shakin' goin' on.
250
Pulpfiction Books @pfbvan.bsky.social · 04/10/2026
Have I got news for you. Signed, Jurassic Ridge v. my knees.
020
Reposted by Pulpfiction Books
Michael Ledger-Lomas @michaelledgerlomas.bsky.social · 03/10/2026
A wonderful way to mark the day that Sim appointed as Chip Wilson Day.
1143
Reposted by Pulpfiction Books
Andrea Woo @andreawoo.bsky.social · 03/10/2026
Hoo boy. A deep dive on the cross-border effort to sway Alberta’s secession vote, from @carrietait.bsky.social, Nathan VanderKlippe and Grant Robertson www.theglobeandmail.com/canada/artic...
A Globe and Mail investigation has found that Republican political operatives were on the ground in Alberta this year to assist the separatist campaign in its bid to leave Canada, while harbouring their own aspirations for the province to secede.

The Globe also found that when Alberta separatist leaders went to Washington to meet with the U.S. State Department, they offered up key assets from the province’s resource portfolio, including access to fresh water and royalties on crude oil, in exchange for help transitioning to independence.

Through interviews with The Globe on both sides of the border, people involved in politics, the corporate sector and Alberta’s pursuit of separatism have described persistent efforts by figures in the U.S. administration and conservative political establishment to support groups seeking American expansionism and independence for Alberta.
23511
Reposted by Pulpfiction Books
Catherine Winters @catherinewinters.com · 03/10/2026
Me, writing a novel set on a decrepit secondhand cargo ship: Haha fuck yeah!!! Yes!! Me checking my feed: Well this fucking sucks. What the fuck."
2102
Pulpfiction Books @pfbvan.bsky.social · 02/10/2026
"I’ve rarely read scenes so terrifying, achieved with a kind of stutter-step language, words that intensify and recede with such incantatory power. These passages seem unparalleled in literature and somehow bypass the brain to jolt the nervous system directly--"
nytimes.com
A Haunting Masterwork From a Writer Who Is Reinventing Fantasy
“The Rouse,” by China Miéville, is a decade-spanning epic about a secret military unit trying to channel supernatural forces.
28111
Reposted by Pulpfiction Books
Jen St. Denis @jenstden.bsky.social · 02/10/2026
Remembering Vancouver music writer Andrea Warner, who died this week of cancer at age 47 This is a beautiful remembrance that includes many links to Andrea's work. www.cbc.ca/music/andrea...
cbc.ca
Saying goodbye to Andrea Warner | CBC Music
We lost one of the very best on Sept. 27.
26017
Reposted by Pulpfiction Books
Dr. Drew Brayshaw 🌊🪨 @drewbrayshaw.bsky.social · 02/10/2026
our pet sitter sent us this pic of ms. beans and yes, 12/10 no notes you have captured the soul essence of my cat
loud chonker
2272
Reposted by Pulpfiction Books
Coach Finstock @coachfinstock.bsky.social · 01/10/2026
The reason they want more people to adopt chatbots is because that could theoretically create a new revenue stream by eliminating the need for marketing or advertising and just taking cash from brands/parties/etc to change what the chatbot tells the user.
638057
Reposted by Pulpfiction Books
Coach Finstock @coachfinstock.bsky.social · 01/10/2026
Dark thread. Since we watched Musk literally push a "protect the Boers" button in real time with Grok, we now know people or companies could theoretically pay their way into putting a thumb on the scale for Grok/Claude/ChatGPT. This is why the AI stans want you to believe it's thinking
15878240
Pulpfiction Books @pfbvan.bsky.social · 01/10/2026
Receipts: National Day for Truth & Reconciliation profits generated $3100 CDN, divided equally, just now, between the Indian Residential School Survivors Society; Urban Native Youth Alliance; Vancouver Aboriginal Child & Family Services Society; and Native Education College. A good start.
0221
Reposted by Pulpfiction Books
Elephant Mastodon @emath.bsky.social · 01/10/2026
I just want to hear an Animorph tell me I'm a good boy.
082
Pulpfiction Books @pfbvan.bsky.social · 30/09/2026
Jurassic Ridge
0753
Reposted by Pulpfiction Books
Michelle Cyca @michellecyca.com · 30/09/2026
recommended reading today — Aaron Hemens’ interview with Phyllis Webstad, published two years ago on @indiginews.bsky.social. Webstad is not even mentioned on the federal government’s webpage for NDTR/Orange Shirt Day indiginews.com/news/orange-...
indiginews.com
Orange Shirt Day’s founder fears Sept. 30 is being co-opted from residential ‘school’ survivors
‘I don’t want Orange Shirt Day to be forgotten — it was started by a survivor,’ says Phyllis Webstad, whose 11-year-old event now coincides with National Day for Truth and Reconciliation
15034
Reposted by Pulpfiction Books
Albert Pinto @70sbachchan.bsky.social · 30/09/2026
"Meta is using its A.I. data centers to exploit a lucrative tax break intended to support research and experimentation, according to an exclusive report by The New York Times. The company’s own accountants recognize that the strategy is on shaky legal ground. " www.nytimes.com/2026/09/30/t...
34213
Pulpfiction Books @pfbvan.bsky.social · 30/09/2026
National Day for Truth & Reconciliation. Both PFB branches open. As always on this day, all profits from today's sales will be donated to a variety of local Indigenous-led groups. Receipts here & on our IG no later than October 7th.
0256
Reposted by Pulpfiction Books
Vajra Chandrasekera @vajra.me · 30/09/2026
My third novel, HERO COME HOME, officially has a cover! Preorderable from the usual places us.macmillan.com/books/978125...
The cover of my third novel, HERO COME HOME. Four human figures centred, the main image being that of a bearded man looking back over his shoulder (that's Oro, the protagonist), with a circle of symbols behind him. We can see a swan and a key. In the foreground are three people: two women, one with a mysterious marking? scar? who knows!? on her cheek and the other carrying a sword, flanking an older, balding man holding up a pistol. The possibly-scarred woman looks ever so slightly amused, and that is certainly very like her. Everybody else is not happy to be here, or indeed, anywhere
56586199
Reposted by Pulpfiction Books
Hypervisible @hypervisible.blacksky.app · 30/09/2026
Eugenics 🤝 ai www.nytimes.com/2026/09/29/h...
One of the things that is going to change is that we’re never ever again going to be able to be dominated by public officials who tell us, ‘Trust the experts,’” Mr. Kennedy said during the Tuesday session.

“If somebody tells you, ‘Masks work, trust the experts,’ A.I. may tell you otherwise,” he added. “If somebody tells you, ‘Social distancing works, trust the experts,’ A.I. may correct that. And if somebody tells you that a vaccine will prevent transmission and infection, or you need to take it to protect your grandmother, A.I. may say it actually doesn’t do that.”
1231779552
Reposted by Pulpfiction Books
Hypervisible @hypervisible.blacksky.app · 29/09/2026
So wild to me that the entire economy is propped up by companies who think living your best life is being a middle manager to a collection of bots.
3596124
Reposted by Pulpfiction Books
Hypervisible @hypervisible.blacksky.app · 29/09/2026
“What if we released malware represented in the form of a cute avatar” is an actual business plan now.
engadget.com
Dots are OpenAI's new personal agents and soon you'll be able to control several of them - Engadget
Sure, seems safe.
621184384
Reposted by Pulpfiction Books
Christina Shah @christinashah.bsky.social · 29/09/2026
Living East Van, Writing East Van: A Literary Panel. Join me at the VPL for a lively reading and conversation with @normannawrocki.bsky.social, Evelyn Lau(!), and Nick Marino Oct 24th, 2:30 pm! 📕 Register here: vpl.bibliocommons.com/events/6a906... #poetry #eastvan #hastings-sunrise
vpl.bibliocommons.com
Living East Van, Writing East Van: A Literary Panel
What does it mean to be an East Van writer? For almost 150 years, East Vancouver has been the predominant home for Vancouver’s immigrant and working-class communities. More than a geographic location...
1164
Reposted by Pulpfiction Books
Andrea Woo @andreawoo.bsky.social · 28/09/2026
Statement from Superintendent Jeff Pelley, officer in charge at Kamloops and Tk’emlúps Rural RCMP, on apparent Second Sons white nationalist gathering on Tk'emlúps te Secwépemc reserve Sunday (Sunday statement from Chief Kúkwpi7 Rosanne Casimir: tinyurl.com/2wbfxay5)
On Sunday September 27, 2026, at approximately 7:25 a.m., frontline officers from the Tk’emlúps RCMP Detachment received a report of a large group of individuals dressed in black clothing and wearing white masks near Chief Eli Larue Way.

 

Our officers responded and engaged immediately with the group who subsequently departed the location and continued throughout various parts of the city.

 

The posting of a banner bearing the words “got bones,” combined with the use of masks to conceal their identities while making such public statements is a cowardly attempt to avoid accountability for actions and messages that are clearly intended to intimidate, provoke fear and division.

 

The RCMP is taking this matter seriously and will continue to engage the group as part of our response and current ongoing investigation.

 

The RCMP’s position on this type of messaging is clear, and such and we will continue to ensure that all offences are thoroughly investigated to support potential prosecution.

 

Anyone with information, photos or video footage of this incident, or knowledge of future gatherings is encouraged to contact the Tk’emlúps Rural RCMP Detachment at 250-314-1800 or the Kamloops RCMP Detachment at 250-828-3000 and cite file 2026-32566.  You can remain anonymous by calling, Crime Stoppers at 1800-222-8477 (TIPS).

 

Superintendent Jeff Pelley

Officer in Charge

Kamloops and Tk’emlúps Rural RCMP
1168
Reposted by Pulpfiction Books
J. Caleb Mozzocco @jcaleb.bsky.social · 28/09/2026
Okay, maybe I'm being a bit facetious with the WATCHMEN comparison. But I've been thinking about Marvel "graphic novels" vs. DC ones, and I have a hard time thinking of any that meet this criteria I lay out in the post (especially the "in print" part):
Two paragraphs snipped from my blog post, detailing six criteria for a certain kind of popular, evergreen graphic novel.
19546
Reposted by Pulpfiction Books
compliancedivision.bsky.social @compliancedivision.bsky.social · 28/09/2026
Mysterious Brake Failure Astounds Investigators _________________________ Mayor to Award Key to City _________________________ Cleanup Volunteers Sought
111
Reposted by Pulpfiction Books
Laird Barron @lairdbarron.bsky.social · 28/09/2026
A country that has to remind you to love it aint no country at all
35613
Reposted by Pulpfiction Books
Doctor Murder, M.D. ☮️🇵🇸 @rottenplanet.bsky.social · 28/09/2026
Seeing this basement Nazi mindrot popping up here utterly disgusts me.
061
Pulpfiction Books @pfbvan.bsky.social · 28/09/2026
Rail -> tar, feathers -> jail -> noose
6859
Pulpfiction Books @pfbvan.bsky.social · 25/09/2026
"I’ve come to believe that the natural world is the greatest teacher of all, and that listening in silence to the universe around you is perhaps the most productive way of learning. So often people are afraid of their own thoughts, resorting to drowning them out with constant noise and distraction."
030
Reposted by Pulpfiction Books
Dr. Drew Brayshaw 🌊🪨 @drewbrayshaw.bsky.social · 24/09/2026
reading feline DNA and the sequence is just TAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACAT
152
Reposted by Pulpfiction Books
Paperback Paradise @paperbackparadise.bsky.social · 24/09/2026
Photo of a vintage book cover featuring a bearded man chopping planks of wood in half. Title and copy read

Defeating Wood

Teach Wood
The Lesson It Has Long Deserved

Gary Arkanasse
253018860
Reposted by Pulpfiction Books
Jack Murphy @jackmurphyrgr.bsky.social · 23/09/2026
Why is it that conservatives are scared shitless of the people that they wish would fuck them in a motel room? You don't have to be Sigmund fucking Freud to figure out what's going on here.
810215
Reposted by Pulpfiction Books
Karlo Yeager Rodríguez @kjy1066.bsky.social · 23/09/2026
The Vanished Birds by Simon Jimenez - amazing post-colonial space opera that released to seeming silence
Cover of The Vanished Birds by Simon Jimenez
2255
Reposted by Pulpfiction Books
Leah Sottile @leahsottile.bsky.social · 23/09/2026
Happy Crone pub day to my pal @keithrosson.bsky.social! If you aren’t reading Keith, what are you even doing?
The cover of Keith Rosson’s book Crone, held against a backdrop of books.
0171
Reposted by Pulpfiction Books
Nicholas Grossman @nicholasgrossman.bsky.social · 22/09/2026
A university doing a special Chris Rufo program, expecting success under the belief there’s widespread public craving for ideological anti-woke “education” to counter all the “Marxism,” then when it turns out virtually no students are interested trying to make it mandatory, didn’t work out? Huh.
1336398
Reposted by Pulpfiction Books
Michael Ledger-Lomas @michaelledgerlomas.bsky.social · 22/09/2026
Meet your TEAM candidates
2202
Pulpfiction Books @pfbvan.bsky.social · 22/09/2026
Orca / Octopus Patrol
080
Pulpfiction Books @pfbvan.bsky.social · 22/09/2026
Quiet last-summer evening on the Salish Sea
0260
Pulpfiction Books @pfbvan.bsky.social · 22/09/2026
✅️
000
Reposted by Pulpfiction Books
Stanley Q Woodvine @sqwabb.bsky.social · 21/09/2026
At counter in #Vancouver South Granville McD's. Someone played with stick-on letters of the "Mobile Order Pick Up" sign. Staff noticed but seemed powerless in the face of such sophisticated vandalism. Did my best to fix it but "R" is gone - pehaps eaten while someone waited for their real order.
Before: "M...bi...e O...der Pick Uplo"After: "Mobile O...der Pick Up"
181
Pulpfiction Books @pfbvan.bsky.social · 21/09/2026
www.westernstandard.news/bc/exclusive...
westernstandard.news
EXCLUSIVE: Caucus faction tells Findlay to resign Saturday night or husband tape drops
PENTICTON — Elements of the Conservative Party of BC caucus have told leader Kerry-Lynne Findlay to resign Saturday evening, two sources said, and have threatened to release a recording of her husband...
100
Pulpfiction Books @pfbvan.bsky.social · 21/09/2026
@duckdeux.bsky.social & I recently ate here. Strip-mall ambiance; attentive & thoughtful service; spice levels ranging from mainstream to shoulda-thoroughly-reconsidered. Momos a dozen ways, Nepali specialties, & some Indo-Chinese mashups. Highly recommended!
momohut.ca
Momo Hut — Best Momo in Vancouver
Experience Nepal, one bite at a time. Authentic Nepalese cuisine on Fraser Street since 2006.
0210