iiinova — where your digital self keeps evolving

Reposted by Pulpfiction Books

recommended reading today — Aaron Hemens’ interview with Phyllis Webstad, published two years ago on @indiginews.bsky.social. Webstad is not even mentioned on the federal government’s webpage for NDTR/Orange Shirt Day indiginews.com/news/orange-...

indiginews.com

Orange Shirt Day’s founder fears Sept. 30 is being co-opted from residential ‘school’ survivors

‘I don’t want Orange Shirt Day to be forgotten — it was started by a survivor,’ says Phyllis Webstad, whose 11-year-old event now coincides with National Day for Truth and Reconciliation

03118

Reposted by Pulpfiction Books

Albert Pinto @70sbachchan.bsky.social · 2h

"Meta is using its A.I. data centers to exploit a lucrative tax break intended to support research and experimentation, according to an exclusive report by The New York Times. The company’s own accountants recognize that the strategy is on shaky legal ground. " www.nytimes.com/2026/09/30/t...

164

Pulpfiction Books @pfbvan.bsky.social · 3h

National Day for Truth & Reconciliation. Both PFB branches open. As always on this day, all profits from today's sales will be donated to a variety of local Indigenous-led groups. Receipts here & on our IG no later than October 7th.

0196

Reposted by Pulpfiction Books

Vajra Chandrasekera @vajra.me · 3h

My third novel, HERO COME HOME, officially has a cover! Preorderable from the usual places us.macmillan.com/books/978125...

The cover of my third novel, HERO COME HOME. Four human figures centred, the main image being that of a bearded man looking back over his shoulder (that's Oro, the protagonist), with a circle of symbols behind him. We can see a swan and a key. In the foreground are three people: two women, one with a mysterious marking? scar? who knows!? on her cheek and the other carrying a sword, flanking an older, balding man holding up a pistol. The possibly-scarred woman looks ever so slightly amused, and that is certainly very like her. Everybody else is not happy to be here, or indeed, anywhere

35365121

Reposted by Pulpfiction Books

Hypervisible @hypervisible.blacksky.app · 18h

Eugenics 🤝 ai www.nytimes.com/2026/09/29/h...

One of the things that is going to change is that we’re never ever again going to be able to be dominated by public officials who tell us, ‘Trust the experts,’” Mr. Kennedy said during the Tuesday session.

“If somebody tells you, ‘Masks work, trust the experts,’ A.I. may tell you otherwise,” he added. “If somebody tells you, ‘Social distancing works, trust the experts,’ A.I. may correct that. And if somebody tells you that a vaccine will prevent transmission and infection, or you need to take it to protect your grandmother, A.I. may say it actually doesn’t do that.”

1081557485

Reposted by Pulpfiction Books

Hypervisible @hypervisible.blacksky.app · 29/09/2026

So wild to me that the entire economy is propped up by companies who think living your best life is being a middle manager to a collection of bots.

3582123

Reposted by Pulpfiction Books

Hypervisible @hypervisible.blacksky.app · 29/09/2026

“What if we released malware represented in the form of a cute avatar” is an actual business plan now.

engadget.com

Dots are OpenAI's new personal agents and soon you'll be able to control several of them - Engadget

Sure, seems safe.

631172379

Reposted by Pulpfiction Books

Christina Shah @christinashah.bsky.social · 29/09/2026

Living East Van, Writing East Van: A Literary Panel. Join me at the VPL for a lively reading and conversation with @normannawrocki.bsky.social, Evelyn Lau(!), and Nick Marino Oct 24th, 2:30 pm! 📕 Register here: vpl.bibliocommons.com/events/6a906... #poetry #eastvan #hastings-sunrise

vpl.bibliocommons.com

Living East Van, Writing East Van: A Literary Panel

What does it mean to be an East Van writer? For almost 150 years, East Vancouver has been the predominant home for Vancouver’s immigrant and working-class communities. More than a geographic location...

1164

Reposted by Pulpfiction Books

Andrea Woo @andreawoo.bsky.social · 28/09/2026

Statement from Superintendent Jeff Pelley, officer in charge at Kamloops and Tk’emlúps Rural RCMP, on apparent Second Sons white nationalist gathering on Tk'emlúps te Secwépemc reserve Sunday (Sunday statement from Chief Kúkwpi7 Rosanne Casimir: tinyurl.com/2wbfxay5)

On Sunday September 27, 2026, at approximately 7:25 a.m., frontline officers from the Tk’emlúps RCMP Detachment received a report of a large group of individuals dressed in black clothing and wearing white masks near Chief Eli Larue Way.

Our officers responded and engaged immediately with the group who subsequently departed the location and continued throughout various parts of the city.

The posting of a banner bearing the words “got bones,” combined with the use of masks to conceal their identities while making such public statements is a cowardly attempt to avoid accountability for actions and messages that are clearly intended to intimidate, provoke fear and division.

The RCMP is taking this matter seriously and will continue to engage the group as part of our response and current ongoing investigation.

The RCMP’s position on this type of messaging is clear, and such and we will continue to ensure that all offences are thoroughly investigated to support potential prosecution.

Anyone with information, photos or video footage of this incident, or knowledge of future gatherings is encouraged to contact the Tk’emlúps Rural RCMP Detachment at 250-314-1800 or the Kamloops RCMP Detachment at 250-828-3000 and cite file 2026-32566. You can remain anonymous by calling, Crime Stoppers at 1800-222-8477 (TIPS).

Superintendent Jeff Pelley

Officer in Charge

Kamloops and Tk’emlúps Rural RCMP

1168

Reposted by Pulpfiction Books

J. Caleb Mozzocco @jcaleb.bsky.social · 28/09/2026

Okay, maybe I'm being a bit facetious with the WATCHMEN comparison. But I've been thinking about Marvel "graphic novels" vs. DC ones, and I have a hard time thinking of any that meet this criteria I lay out in the post (especially the "in print" part):

Two paragraphs snipped from my blog post, detailing six criteria for a certain kind of popular, evergreen graphic novel.

19546

Reposted by Pulpfiction Books

compliancedivision.bsky.social @compliancedivision.bsky.social · 28/09/2026

Mysterious Brake Failure Astounds Investigators _________________________ Mayor to Award Key to City _________________________ Cleanup Volunteers Sought

111

Reposted by Pulpfiction Books

Laird Barron @lairdbarron.bsky.social · 28/09/2026

A country that has to remind you to love it aint no country at all

35613

Reposted by Pulpfiction Books

Doctor Murder, M.D. ☮️🇵🇸 @rottenplanet.bsky.social · 28/09/2026

Seeing this basement Nazi mindrot popping up here utterly disgusts me.

061

Pulpfiction Books @pfbvan.bsky.social · 28/09/2026

Rail -> tar, feathers -> jail -> noose

6859

Pulpfiction Books @pfbvan.bsky.social · 25/09/2026

"I’ve come to believe that the natural world is the greatest teacher of all, and that listening in silence to the universe around you is perhaps the most productive way of learning. So often people are afraid of their own thoughts, resorting to drowning them out with constant noise and distraction."

030

Reposted by Pulpfiction Books

Dr. Drew Brayshaw 🌊🪨 @drewbrayshaw.bsky.social · 24/09/2026

reading feline DNA and the sequence is just TAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACAT

152

Reposted by Pulpfiction Books

Jack Murphy @jackmurphyrgr.bsky.social · 23/09/2026

Why is it that conservatives are scared shitless of the people that they wish would fuck them in a motel room? You don't have to be Sigmund fucking Freud to figure out what's going on here.

810315

Reposted by Pulpfiction Books

Karlo Yeager Rodríguez @kjy1066.bsky.social · 23/09/2026

The Vanished Birds by Simon Jimenez - amazing post-colonial space opera that released to seeming silence

Cover of The Vanished Birds by Simon Jimenez

2255

Reposted by Pulpfiction Books

Leah Sottile @leahsottile.bsky.social · 23/09/2026

Happy Crone pub day to my pal @keithrosson.bsky.social! If you aren’t reading Keith, what are you even doing?

The cover of Keith Rosson’s book Crone, held against a backdrop of books.

0171

Reposted by Pulpfiction Books

Nicholas Grossman @nicholasgrossman.bsky.social · 22/09/2026

A university doing a special Chris Rufo program, expecting success under the belief there’s widespread public craving for ideological anti-woke “education” to counter all the “Marxism,” then when it turns out virtually no students are interested trying to make it mandatory, didn’t work out? Huh.

1336398

Reposted by Pulpfiction Books

Michael Ledger-Lomas @michaelledgerlomas.bsky.social · 22/09/2026

Meet your TEAM candidates

2202

Pulpfiction Books @pfbvan.bsky.social · 22/09/2026

Quiet last-summer evening on the Salish Sea

0260

Reposted by Pulpfiction Books

Stanley Q Woodvine @sqwabb.bsky.social · 21/09/2026

At counter in #Vancouver South Granville McD's. Someone played with stick-on letters of the "Mobile Order Pick Up" sign. Staff noticed but seemed powerless in the face of such sophisticated vandalism. Did my best to fix it but "R" is gone - pehaps eaten while someone waited for their real order.

181

Pulpfiction Books @pfbvan.bsky.social · 21/09/2026

@duckdeux.bsky.social & I recently ate here. Strip-mall ambiance; attentive & thoughtful service; spice levels ranging from mainstream to shoulda-thoroughly-reconsidered. Momos a dozen ways, Nepali specialties, & some Indo-Chinese mashups. Highly recommended!

momohut.ca

Momo Hut — Best Momo in Vancouver

Experience Nepal, one bite at a time. Authentic Nepalese cuisine on Fraser Street since 2006.

0210

Pulpfiction Books @pfbvan.bsky.social · 21/09/2026

Husband Tape must be pure Kryptonite

1120

Reposted by Pulpfiction Books

Elephant Mastodon @emath.bsky.social · 20/09/2026

What a horrible day for me, the guy who makes and sells finely crafted figurines of party leaders outside the BC Legislature.

08112

Pulpfiction Books @pfbvan.bsky.social · 20/09/2026

Department of Foregone Conclusions

3141

Reposted by Pulpfiction Books

#BruceSterling @bruces.bsky.social · 20/09/2026

*Flybrain slop is distinct from other forms of AI slop because the AI you are using is an objet trouvee. A map of connections in a fly brain is not the fly's "intelligence." But it's an interesting found-object, and can be put to other purposes, like with music sampling, or carving driftwood.

0193

Pulpfiction Books @pfbvan.bsky.social · 19/09/2026

Longtime client's birthday gift "from a friend who knows me well." Funnier if you live in BC & know the graphic-design nod.

51349

Reposted by Pulpfiction Books

Nicholas Grossman @nicholasgrossman.bsky.social · 19/09/2026

When the US bombed an Iranian school, killing over 100 kids, it involved over-reliance on an AI targeting system called "Maven," which based it on outdated information. I called it in @foreignpolicy.com in April Now confirmed in @bloomberg.com report of Pentagon investigation

Keep Humans in the Loop
AI has a place in military targeting—but it needs safeguards.

By Nicholas Grossman, a professor of international relations at the University of Illinois, editor of Arc Digital, and the author of Drones and Terrorism.

Pictured: A woman passes an art installation featuring portraits of some of the school girls killed in an apparent U.S. strike in February, in Tehran.on April 12. MAJID SAEEDI/GETTY IMAGES)

https://foreignpolicy.com/2026/04/14/ai-targeting-iran-school-airstrikes-pentagon-anthropic/

APRIL 14, 2026, 1:57 PM
In the U.S.-Israel war on Iran, airstrikes hit an elementary school in Iran, killing at least 175, most of them children.

From: https://foreignpolicy.com/2026/04/14/ai-targeting-iran-school-airstrikes-pentagon-anthropic/

This time, AI may have played a role, perhaps relying on old information. The school was adjacent to Iranian naval facilities and had once been a part of them. A large language model like Claude or ChatGPT could make that kind of error by consuming outdated information at a higher volume and giving it greater weight than more current info—or perhaps by failing to spot something a human might have caught, such as a school sign or children playing.

From: https://foreignpolicy.com/2026/04/14/ai-targeting-iran-school-airstrikes-pentagon-anthropic/

The public doesn’t know if AI chose the Iranian school, but we know the U.S. military is using an AI-powered system called Maven in Iran to help identify targets. Similarly, the Israeli military used a system called Lavender to identify targets in Gaza. Both wars featured a record-high rate of precision strikes compared to previous air campaigns.

https://foreignpolicy.com/2026/04/14/ai-targeting-iran-school-airstrikes-pentagon-anthropic/

11345121

Reposted by Pulpfiction Books

Faine Greenwood @faineg.com · 18/09/2026

In isolation, I’m OK with futurists. I’m OK with futurists who have wild and crazy ideas about long term risks. The problem is that we somehow have let the kooky little “what if Dyson spheres had feelings” guys almost entirely take over the US AI regulatory space, and that’s *really bad*.

1230948

Reposted by Pulpfiction Books

Timothy Snyder @timothysnyder.bsky.social · 18/09/2026

(2/2) The president of the United States says things that are not only false and cruel but which only Russians could have instructed him to say, since there is no way he could have thought of them himself, and since they depend on knowledge that he does not have.

281526407

Reposted by Pulpfiction Books

Timothy Snyder @timothysnyder.bsky.social · 18/09/2026

It is not humiliating for him, since he has no sense of dignity, but it is humiliating for the rest of us that the president of the United States serves as a subordinate press officer of the Kremlin. (1/2)

322310674

Reposted by Pulpfiction Books

Andrew Kurjata @akurjata.ca · 18/09/2026

We’ve launched a livepage to cover ~whatever is happening~ in B.C politics today www.cbc.ca/news/canada/... #bcpoli

cbc.ca

Former B.C. Conservative holds news conference with centrist party leader after 3 more MLAs leave opposition | CBC

6218

Reposted by Pulpfiction Books

Dr. Drew Brayshaw 🌊🪨 @drewbrayshaw.bsky.social · 18/09/2026

10, 11, and 12 At some point the number of MLAs left in the party will be the limiting factor to the number who can quit, leave or be ousted in a day

041

Reposted by Pulpfiction Books

Joanne Hammond @joannehammond.bsky.social · 18/09/2026

The phenomenon the rest of us see isn’t just Trump though. It’s that he’s been duly elected by 63-75 million people, twice, and the US institutions that supposedly exist to balance the power of one entitled man all just capitulated right away. That’s harder to forget.

0183

Reposted by Pulpfiction Books

Andrew Couts @couts.bsky.social · 18/09/2026

Absolutely horrific: Thanks to a false intelligence "generated with the help of artificial intelligence," the US military nearly carried out an operation aboard a Chinese ship because the incorrect intelligence said it was carrying nukes, according to @cnn.com. edition.cnn.com/2026/09/18/p...

edition.cnn.com

Exclusive: US military had close call after using AI for false intelligence report, sources say | CNN Politics

The episode shows the risks of using this new, relatively poorly understood technology in the middle of the Iran war

441019488

Reposted by Pulpfiction Books

Discontinued Foods! @discontinuedfoods.bsky.social · 18/09/2026

Beans all over.

551047166

Pulpfiction Books @pfbvan.bsky.social · 18/09/2026

Excellent profile of Scary Grandma

0130

Reposted by Pulpfiction Books

Faine Greenwood @faineg.com · 18/09/2026

you stop being able to play the “we are but a smol bean polycule like anybody else in a coastal city” card when billions of dollars and vast power are involved

1047735

Reposted by Pulpfiction Books

Faine Greenwood @faineg.com · 18/09/2026

it’s a sex cult because of the way it acts like a sex cult. I know lots of people who have group sex and are in polycules who are perfectly normal and cool. That is not what is happening here for a bunch of reasons, chief among them “huge amounts of money and power are involved.”

348930

Reposted by Pulpfiction Books

Faine Greenwood @faineg.com · 18/09/2026

So about that batshit insane AI millenarian Silicon Valley sex cult running much of big tech….from Sonia Joseph: siliconvalleynotes.substack.com/p/agi-cnc-an...

Sonia Joseph y @soniajoseph_
To the journalists contacting me about the AGI consensual non-consensual (cnc) sex parties—
During my twenties in Silicon Valley, I ran among elite tech/Al circles through the community house scene. I have seen some troubling things around social circles of early OpenAl employees, their friends, and adjacent entrepreneurs, which I have not previously spoken about publicly.
It is not my place to speak as to why Jan Leike and the superalignment team resigned. I have no idea why and cannot make any claims.
However, I do believe my cultural observations of the SF Al scene are more broadly relevant to the Al industry.
I don't think events like the consensual non-consensual (cnc) sex parties and heavy LSD use of some elite Al researchers have been good for women. They create a climate that can be very bad for female Al researchers, with broader implications relevant to X-risk and AGI safety. I believe they are somewhat emblematic of broader problems: a coercive climate that normalizes recklessness and crossing boundaries, which we are seeing playing out more broadly in the industry today. Move fast and break things, applied to people.
There is nothing wrong imo with sex parties and heavy LSD use in theory, but combined with the shadow of 100B+ interest groups, leads to some of the most coercive and fucked up social dynamics that I have ever seen. The climate was like a fratty LSD version of 2008 Wall Street bankers, which bodes ill for Al safety.

33921220

Reposted by Pulpfiction Books

Jason Kint @kint.bsky.social · 17/09/2026

Eye popping. Court just unsealed Summary Judgment motions in New York Times v OpenAI / Microsoft. Easy to see why the AI companies had so many redactions (pink). Their own people wrote the lede for NYT, the "largest theft of labor in human history"... "more and more substitutive..." /1

4253422316