iiinova — where your digital self keeps evolving

Reposted by VastDB

tahneema.bsky.social @tahneema.bsky.social · 28/06/2026

Very excited to finally share my PhD! 🎉 Our paper, “Neuronal microexons modulate arousal via the cAMP-PKA-CREB pathway in zebrafish,” is now published in Science Advances. Many thanks to all of my co-authors, and especially to @mirimiam.bsky.social! 📄 www.science.org/doi/10.1126/...

science.org

Neuronal microexons modulate arousal via the cAMP-PKA-CREB pathway in zebrafish

Loss of the conserved splicing factor for neuronal microexons disrupts neuromodulatory signaling and drives hyperarousal.

085

Reposted by VastDB

Manuel Irimia @mirimiam.bsky.social · 02/03/2026

🚨🧬🚨 We're looking for a specialized Research Assistant to spearhead a project aimed at exploring new RNA therapeutics in diabetes and other metabolic disorders. Junior or Senior, we're hoping to recruit a highly motivated and self-driven scientist interested in both basic and applied science. 🦄

0711

Reposted by VastDB

EvoMG Program @evomg-bcn.bsky.social · 05/11/2025

Today we had a great EvoMG Seminar by Dario Valenzano @dvalenzano.bsky.social from FLI, who told us about some of their recent aging work using the fascinating short-lived killifish. Hosted by @mirimiam.bsky.social evomedgenomics.com/events/exter...

0115

Reposted by VastDB

Manuel Irimia @mirimiam.bsky.social · 22/09/2025

Last days to apply! Cool project, cool cities! :-) (Please repost! 🙏)

01216

Reposted by VastDB

Arnau Sebé-Pedrós @arnausebe.bsky.social · 24/09/2025

Happy to share the Biodiversity Cell Atlas white paper, out today in @nature.com. We look at the possibilities, challenges, and potential impacts of molecularly mapping cells across the tree of life. www.nature.com/articles/s41...

4230107

Reposted by VastDB

Manuel Irimia @mirimiam.bsky.social · 01/09/2025

🚨🚨🚨 New review article on #microexons from the lab! A comprehensive recap of the current state of the field by @tahneema.bsky.social. www.annualreviews.org/content/jour...

Network plot with microexon-associated phenotypes (nodes shown in dark gray). Microexon nodes are colored by exon length, and node size represents the level of conservation to the LCA as given in VastDB (109): human specific, Euarchontoglires (conserved from human to mouse and/or rat), Eutheria (to cow), Amniota (to chicken), Euteleostomi (to zebrafish), and Bilateria (to fruit fly).

0153

Reposted by VastDB

Manuel Irimia @mirimiam.bsky.social · 23/07/2025

🚨🚨🚨 Please RT! We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets. Deadline: 30/09/25👇

upf.edu

14865

Reposted by VastDB

Manuel Irimia @mirimiam.bsky.social · 18/03/2025

"The main fates after gene duplication are gene loss, redundancy, subfunctionalization and neofunctionalization". In our new review, @fedemantica.bsky.social and I argue we are missing the most prevalent one: specialization. And the same applies to alternative splicing! 1/7 tinyurl.com/45k7kbmp

24116

Reposted by VastDB

Manuel Irimia @mirimiam.bsky.social · 30/12/2024

🐟 Our new paper "Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish" is out in @elife.bsky.social 🐟 A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @crg.eu & @upf.edu elifesciences.org/reviewed-pre... Thread 👇1/9

elifesciences.org

Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish

23215

Reposted by VastDB

Manuel Irimia @mirimiam.bsky.social · 23/12/2024

🚨🚨🚨 If you're a bioinformatician who loves: 🧬 #SingleCell #LongReadSequencing & #AlternativeSplicing 🚀 Collaborating and travelling Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu-@crg.eu in Barcelona. Qs: www.transdevolab.com Please RT! 🙏

02528

Reposted by VastDB

Manuel Irimia @mirimiam.bsky.social · 10/12/2024

We’re recruiting a PhD student to use comparative omics to investigate why some viruses can efficiently infect both human and mosquito cells, but lead to different infection outcomes. Fully funded position by @evomg-bcn.bsky.social at our lab at UPF-CRG and the Diez lab. www.crg.eu/en/content/t...

02322

Reposted by VastDB

Manuel Irimia @mirimiam.bsky.social · 05/12/2024

Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work! english.elpais.com/science-tech...

english.elpais.com

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders

1356