iiinova — where your digital self keeps evolving

DAWells @sciencewells.bsky.social · 05/09/2026

What's your favorite recombination detection tool? and is it fast? 🧬🖥️

DAWells @sciencewells.bsky.social · 05/09/2026

Virus phylogenetics get much harder when they start recombining (which I assume they do out of spite). Here's an mpox genome in 17 blocks from 2 strains 🦠🧪 Which means this 1 virus has 2 evolutionary histories🧬🖥️

140

DAWells @sciencewells.bsky.social · 02/09/2026

Apparently biotech 🧪 has been the best performing industry in the US stock market over the last 12 months. What do you think that means for job security and opportunities? 🧬🖥️

032

DAWells @sciencewells.bsky.social · 25/08/2026

Using whole virus genomes, rather than a short section of one gene, more clearly shows which viruses are the same outbreak 🖥️🧬 This is needed now because vaccines have wiped out so many Measels strains. In 1990 there were 18, by 2021 global vaccination programs had eliminated 16 of them 💉🧪

140

DAWells @sciencewells.bsky.social · 25/08/2026

The US Measels elimination status is under review, and rests on whether the current cases are a single outbreak lasting over 12 months 🧪🦠 For the first time this question is being answered using viral genomics 🧬🖥️

161

DAWells @sciencewells.bsky.social · 23/08/2026

Cool weird things are happening in the other groups. Like hepatitis B with a 1.5 stranded DNA genome. What's your favorite bizarre genome?

110

DAWells @sciencewells.bsky.social · 22/08/2026

Viruses looked at double stranded DNA, and decided it was too basic #Baltimore 🧬🧪 #ViroSky #VirEvol

120

DAWells @sciencewells.bsky.social · 19/08/2026

Mycobacterium immunogenum 🦠 is often found in metal working fluids and can cause lung disease in machinists. Interestingly it's not an infection, it just causes the immune system to flare up and that damages the lungs 🧪

121

DAWells @sciencewells.bsky.social · 14/08/2026

Last year, untargeted sequencing was able to detect a single case of measles in the collective wastewater of 1 million people 🧬🖥️. Untargeted sequencing can detect any pathogen with any mutation. But they needed ultra deep sequencing to detect the 1 in 1,000,000 case 🧪 doi.org/10.1056/EVIDpha2600079

doi.org

Detection of a Single Measles Infection Using Untargeted Ultra-Deep Metagenomic Sequencing of Wastewater in Cook County, Illinois

Measles is a contagious, vaccine-preventable viral disease that can be shed into wastewater by infected individuals. In September 2025, as part of an ongoing, nontargeted, ultra-deep metagenomic se...

161

DAWells @sciencewells.bsky.social · 05/08/2026

A mutation in a strain of measles allowed it to go undetected by common targeted sequencing surveillance 🧬. The assay has now been updated to detect the mutant 🖥️. Targeted sequencing is incredibly sensitive but it must be supported by genomic surveillance to keep the targets up to date 🧪🦠

1158

DAWells @sciencewells.bsky.social · 04/08/2026

During London tube strikes, commuters had to change their underground route 🚇. 5% preferred their new route and kept using it after the strikes were over. What changes have you kept after forced exploration?

000

DAWells @sciencewells.bsky.social · 03/08/2026

Slow growing bacterial infections are not just a challenge for id and culture. Their slow growth also makes treatment slower. Mycobacterium malmoense 🦠 takes 2 months to grow on a plate and 2 years of antibiotics to treat. 🧪

171

Reposted by DAWells

Ted Pavlic (he/him/his) @tedpavlic.bsky.social · 23/07/2026

For students who look to LLMs for help with their code but run into usage limits, running an open-weight LLM locally doesn't use up that much storage space and may have similar latency as cloud solutions -- and easy to connect to Positron, VSCode, and others. www.xda-developers.com/self-hosting...

xda-developers.com

I started self-hosting an LLM, and it became my favorite productivity tool

I installed a local LLM for privacy, but the biggest surprise was how much faster it made my daily workflow.

051

DAWells @sciencewells.bsky.social · 22/07/2026

New Zealand has become the last place to detect 2.3.4.4b bird flu (high pathogenicity H5N1). After even Antarctica (2023). 🧪 It's a worry for their native birds, but they've been proactively preparing by vaccinating endangered birds. 💉🦜

1182

DAWells @sciencewells.bsky.social · 15/07/2026

Just an incredible achievement to get a new vaccine to clinical trial in just 8 weeks. Obviously still lots to do, but this shows what pandemic preparedness is capable of. 🧪💉 www.ox.ac.uk/news/2026-07-13-worlds-first-phase-i-bundibugyo-ebolavirus-vaccine-trial-launched-by

ox.ac.uk

World’s first Phase I Bundibugyo ebolavirus vaccine trial launched by Oxford Vaccine Group

The trial will assess the safety and immune response of the ChAdOx1 BDBV vaccine in 50 healthy adults aged 18–55 years.

043

DAWells @sciencewells.bsky.social · 14/07/2026

Is there mould on the international space station 🚀🦠? I analyzed DNA from the ISS dinner table 🧬🖥️, my favorite find was lots of kimchi bacteria. Kimchi went to space, but the bacteria was killed first. 🧪 Why do you think kimchi bacteria doing so well in space? towardsdatascience.com/space-mould/

towardsdatascience.com

Identifying Microbes in Space | Towards Data Science

What's living on the International Space Station?

1156

DAWells @sciencewells.bsky.social · 08/07/2026

Hi Dan, please can you add me to the science communicators list? Here's a recent piece I wrote on metagenomics in space towardsdatascience.com/space-mould/

towardsdatascience.com

Identifying Microbes in Space | Towards Data Science

What's living on the International Space Station?

000

DAWells @sciencewells.bsky.social · 08/07/2026

What's living on the international space station dinner table? I used metagenomics to investigate and found a tasty surprise! 🧪🧬🖥️This blog walks through the code, what microbes I found, and how kraken2 works towardsdatascience.com/space-mould/

towardsdatascience.com

Identifying Microbes in Space | Towards Data Science

What's living on the International Space Station?

020

DAWells @sciencewells.bsky.social · 23/06/2026

Find this mouth in the garden recently. Can anybody help me to ID? Plants 🌱🇬🇧 #bugsky

200

DAWells @sciencewells.bsky.social · 22/06/2026

My new favorite website map.blitzortung.org 🌩️⚡ not just for awesome live data vis but for the collaboration of weather nerds building lightning detectors and sharing the data

map.blitzortung.org

Blitzortung.org - Live Lightning Map

See lightning strikes in realtime nearby your area. Get free online access to maps of former and current thunderstorms. A contribution by Blitzortung.org and contributors.

000

DAWells @sciencewells.bsky.social · 20/06/2026

*looks sceptical in perl* 🐪🧬🖥️🧪

2110

Reposted by DAWells

Michael Le Page @mjflepage.bsky.social · 17/06/2026

Delighted to share some good news 🧪 “This hugely encouraging news shows the life-saving impact of the HPV vaccine, and it’s incredibly exciting to be able to say to this whole generation: cervical cancer shouldn’t be a risk for you,” says Caroline Temmink www.newscientist.com/article/2530...

newscientist.com

No young women have died of cervical cancer in England for years

We already know the vaccine against human papillomavirus, or HPV, greatly reduces infections and cases of cervical cancer, and now we have the first evidence it prevents deaths too

5695226

DAWells @sciencewells.bsky.social · 19/06/2026

Hantaviruses use "cap snatching" to start reading instructions from their genome. They cut up host mRNA and use that as primers for their own transcription. You can see this in their transcripts because they start with unrelated fragments of host sequence 🧪🧬🦠

030

DAWells @sciencewells.bsky.social · 10/06/2026

New flu study shows that when you feel worse, you're probably spreading more virus particles. 🧪In particular, coughing, runny nose, and feeling bleh were correlated with virus particles expelled into the air. #flu www.cell.com/cell/fulltext/S0092-8674(26)00232-1

cell.com

Controlled human influenza infection reveals heterogeneous expulsion of infectious virus into air

A platform called MIST enables quantification and genotyping of infectious influenza in expelled respiratory particles, revealing diverse, individual-specific viral loads and aerosolized variants that...

0104

DAWells @sciencewells.bsky.social · 05/06/2026

In humans, sub unit vaccines are often designed around predicted t cell epitopes. What you would focus on in species without an adaptive immune response is such an interesting question! 🧬🖥️🧪

043

DAWells @sciencewells.bsky.social · 02/06/2026

The Indian muntjac deer only has 6 or 7 chromosomes, less than any other mammal 🦌 because in the last 5 million years their chromosomes have fused together 26 times! 🧬 🖥️ #chromosome #deer

000

DAWells @sciencewells.bsky.social · 01/06/2026

I recently learnt that muntjac deer are native to South East Asia. At the start of the 1900s a handful escaped from a private collection at Woburn Abbey. Despite this population bottleneck, there are now over 100,000 in the UK

000

DAWells @sciencewells.bsky.social · 09/05/2026

There have been 52 space missions with dogs on board but only two with cats, and I can't tell if I'm surprised or not #figtreemap

Animal silhouettes where size is proportional to number of space missions. The largest silhouettes are dog, rat, mouse, and fly.

010

DAWells @sciencewells.bsky.social · 08/05/2026

Very cool! I would love to have a play with the abundance data because I made #figtreemap to try and make more intuitive species abundance plots.

120

Reposted by DAWells

Rajarshi Sanyal @rajarshisanyal.bsky.social · 06/05/2026

India’s genomic map reveals ~130M variants—many previously unknown. Strong population structure + rare, population-specific variants expose limits of Eurocentric datasets. Precision medicine needs diversity, not assumptions. #Genomics #PrecisionMedicine #HumanDiversity tinyurl.com/3mverx3p

tinyurl.com

India’s DNA map uncovers millions of missing genetic variants

A vast study reveals deep diversity, hidden disease risks and exposes the limits of Eurocentric medicine.

022

DAWells @sciencewells.bsky.social · 05/05/2026

Here's a demo using HLAfreq to predict autoimmune disease rates from HLA allele frequencies 🧪🖥️🧬 towardsdatascience.com/estimating-disease-rates-without-diagnosis/ #hlafreq

towardsdatascience.com

Estimating Disease Rates Without Diagnosis | Towards Data Science

Immune genes as predictors of disease

010

DAWells @sciencewells.bsky.social · 05/05/2026

Very happy to say that the 🧬 🖥️ tool HLAfreq is now published doi.org/10.21105/joss.10122 Use it to combine HLA allele frequency datasets. I made it to help vaccine design but love seeing it put to other uses. Let me know if it's useful to you! 🧪 #hlafreq

doi.org

HLAfreq: Download and combine HLA allele frequency data

Wells et al., (2026). HLAfreq: Download and combine HLA allele frequency data. Journal of Open Source Software, 11(121), 10122, https://doi.org/10.21105/joss.10122

110

DAWells @sciencewells.bsky.social · 26/04/2026

The USDA pomological watercolors are a beautiful catalog of fruit in America. I made this figure to show which fruit are in that collection. The bigger the fruit the more times it features in the collection. It is full of apples 🍎🍏! Made with #figtreemap #sciart #apples

Treemap of fruit watercolours, half the image is apples

030

DAWells @sciencewells.bsky.social · 24/04/2026

The USDA phonological watercolors are a collection of beautiful botanical illustrations I've been admiring. Exploring then was made much easier thanks to pomological.art/. Are there any similar collections of animal scientific illustrations you'd recommend? #sciart

pomological.art

USDA Pomological Watercolor Collection

Explore over 7,500 historical watercolor paintings of fruits and vegetables from the USDA Pomological Collection, featuring rare varieties from 1886-1942.

120

DAWells @sciencewells.bsky.social · 23/04/2026

Hi @erynmcfarlane.bsky.social please add me to the list. I'm working on infectious disease genomics and I want to encourage people to get into bioinformatics. scholar.google.co.uk/citations?hl...

scholar.google.co.uk

020

DAWells @sciencewells.bsky.social · 21/04/2026

Exploring cancer types with neo4j, a guide to identifying clusters in knowledge graphs 🧬🖥️🧪 @neo4j.com medium.com/data-science...

medium.com

Exploring cancer types with neo4j

How to identify and visualise clusters in knowledge graphs

020

Reposted by DAWells

Healthcare Infection Society @hisinfection.bsky.social · 21/04/2026

📢Introducing GENOTIPE, HIS Special Interest Group. 🧬GENOTIPE brings together the expertise needed to turn genomic innovation into practical and sustainable use within healthcare settings, aligned with NHS and public health priorities. 🔗More info: ow.ly/JMWY50YNm7k #Genomics #IPC #🧪

011

Reposted by DAWells

Nature @nature.com · 20/04/2026

Computer scientists share their advice for ensuring that your scientific software does what it’s supposed to do go.nature.com/48wyHXp

go.nature.com

Got bugs? Here’s how to catch the errors in your scientific software

Computer scientists share their advice for ensuring that your scientific software does what it’s supposed to do.

0213

Reposted by DAWells

Kristina Killgrove @killgrove.bsky.social · 18/04/2026

Scientists have confirmed that group A strep can be identified in ancient remains. They found pathogen DNA in a prehispanic mummy from Bolivia — raising the question: Where did strep (and diseases like scarlet fever) originate? 🧪🏺

livescience.com

700-year-old mummy from Bolivia contains earliest confirmed evidence of strep throat bacteria in the Americas

A DNA analysis of pathogens from a pre-Hispanic mummy revealed that the bacterium that causes scarlet fever and strep throat was present in the Americas prior to European colonization.

29040

DAWells @sciencewells.bsky.social · 18/04/2026

The number of spaces missions per animal species 🐕🚀. Inspired by [animals in space](www.nationalgeographic.com/magazine/gra...) made with [figtreemap](quantitative-omics-research.github.io/figtreemap/) #space

Treemap of the number of space missions per species

110

DAWells @sciencewells.bsky.social · 17/04/2026

Gorgeous! Reminds me of ggpomological garrickadenbuie.com/project/ggpomological/#color-palette a beautiful colour palette and ggplot theme 🍎🍏

garrickadenbuie.com

🍑 ggpomological: A Pomological ggplot2 Theme – Garrick Aden-Buie

A ggplot2 theme based on the USDA Pomological Watercolor Collection

010

Reposted by DAWells

SK Winnicki, PhD 🏳️‍⚧️ @skwinnicki.bsky.social · 15/04/2026

Of course, that's great because I love White-throated Sparrows so much. Did you know that their two color morphs aren't actually the male and female plumages (as some old field guides say)? Thanks to a genetic quirk, they've basically got 4 sexes! www.sciencehistory.org/stories/disa...

sciencehistory.org

The Bird with Four Sexes

Find out what a strange little sparrow can teach us about love, sex, and human biology.

35512

DAWells @sciencewells.bsky.social · 15/04/2026

CATGAACTGCTGCAGTGGCAGCGCCTGGAT

010