iiinova — where your digital self keeps evolving

Reposted by አዲስ

todaysflag.bsky.social @todaysflag.bsky.social · 17h

Flag of Aloja, Latvia

A white and green diband flag with three leaves outlined in black, two green on the white band and one white on the green band. End alt text.

031

አዲስ @uusisuru.bsky.social · 01/10/2026

My parents brought me donuts from Texas 🤠

000

Reposted by አዲስ

Alan Cleaver @postalpathsguy.bsky.social · 01/10/2026

It is World Postcard Day and amazingly a painted postcard I entered in a Winsor & Newton competition has been chosen for a postcard exhibition at London's Saatchi Gallery! The exhibition runs from October 1 to the 11th at the Saatchi Gallery, London, SW3 4RY. #WorldPostcardDay

Painted postcard of a duckling with a L plate round his neck standing nervously by the edge of a pond from which a sign saying 'Deep End' is showing.

1163

Reposted by አዲስ

Dr. Peter Paul Rubens @peterpaulrubens.bsky.social · 29/09/2026

My own version of Medusa's head. Also pretty grim. My friend Frans Snyders did the creepy-crawlies, but the ghastly face is all mine.

3423

Reposted by አዲስ

Dr. Peter Paul Rubens @peterpaulrubens.bsky.social · 29/09/2026

Men messing with women's (or gorgon's) heads du jour: Medusa's shrieking head on shield of Perseus, 1597, by Caravaggio. It's his birthday.

310816

Reposted by አዲስ

ArtButMakeItSports @artbutmakeitsports.bsky.social · 29/09/2026

Circus Performers, by Walt Kuhn, 1978, 📸 via @marisakabas.bsky.social

177124142658

አዲስ @uusisuru.bsky.social · 29/09/2026

In honor of Caravaggio’s birthday, my #pinstory today:

Enamel pin on dark blue work shirt collar. Pin is of Caravaggio’s “Medusa” painting.

001

Reposted by አዲስ

Dr. Peter Paul Rubens @peterpaulrubens.bsky.social · 28/09/2026

2/2 Another moment in which the cat nabs a bird brutally killed to provide prop for still-life painter. Right? By Carstiaen Luycks again.

1321

Reposted by አዲስ

Dr. Peter Paul Rubens @peterpaulrubens.bsky.social · 28/09/2026

Cat nabs dead bird from cruel still-life painter's arrangement. At least, I'd like to think that's what happened! By Carstiaen Luycks, whose day is today.

38811

አዲስ @uusisuru.bsky.social · 26/09/2026

It’s my final week at my current assignment 🫠 Feeling anxious, but also: fuck it.

static.klipy.com

The Final Countdown Music Video

ALT: The Final Countdown Music Video

100

Reposted by አዲስ

Monica H Green @monicamedhist.bsky.social · 24/09/2026

Very cool! The Medieval Academy of America & @uchicagopress.bsky.social have kindly agreed to temporarily lift the paywall on a short essay I published a few months ago: www.journals.uchicago.edu/doi/10.1086/.... Dating, dating, dating. Vital for the historian; essential for interdisc. dialogue.

journals.uchicago.edu

The Future of Time: Methodological Dialogues between Philology, Archaeology, and Genomics | Speculum: Vol 101, No 1

26025

Reposted by አዲስ

todaysflag.bsky.social @todaysflag.bsky.social · 25/09/2026

Flag of Pisz, Warmian-Masurian Voivodeship, Poland

041

Reposted by አዲስ

Dr. Drew Brayshaw 🌊🪨 @drewbrayshaw.bsky.social · 24/09/2026

reading feline DNA and the sequence is just TAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACATTAGACAT

152

Reposted by አዲስ

The Handwritten Letter Appreciation Society @letterappsoc.bsky.social · 24/09/2026

It’s #WorldPostcardDay one week today, lovely postcard posters! Let’s get ready to fill our postboxes with postcards to friends, family, famous folk, authors, local heroes, the library, your old school, MPs, the CEO of Royal Mail (that’s freepost too!) or whoever you want! 🥰📮🎉

2149

Reposted by አዲስ

Present & Correct @presentcorrect.bsky.social · 23/09/2026

Par Avion. www.presentandcorrect.com/blogs/blog/p...

06015

Reposted by አዲስ

Postcard From The Past @pastpostcard.bsky.social · 20/08/2026

It was very kind of you to remember me.

724142

Reposted by አዲስ

Present & Correct @presentcorrect.bsky.social · 21/09/2026

If you were born between Jan 1st and December 31st your star sign is Stationery. ✏️📐🖊️📎✂️📓🖍️

17911

Reposted by አዲስ

Bloc Party @blocparty.com · 21/09/2026

Muscleworks. Anatomy of A Brief Romance is out now.

051

Reposted by አዲስ

Old English Wordhord @oewordhord.bsky.social · 20/09/2026

eodor, m.n: enclosure, fence, hedge, wall; zone, region; protector, protective lord. (EH-oh-dor / ˈɛɔ-dɔr) Image: Livre d'Heures de Jean Sans Peur; Flanders, 1409-1419; @labnf.bsky.social Département des manuscrits, NAL 3055, f. 178v. #OldEnglish #WOTD

Medieval manuscript image of a man looking beyond the fence that surrounds a small building, a lantern in his lands; the wooden gate in the fence is shut.

0265

አዲስ @uusisuru.bsky.social · 20/09/2026

Because it’s still #Caturday, here’s @adamkoford.com’s series “The Lowell Cats.” www.flickr.com/photos/apela...

flickr.com

The Lowell Cats

They are the worst cats.

050

አዲስ @uusisuru.bsky.social · 20/09/2026

This boy is so sweet: when others are expecting kibbles, he just wants love.

Black and white cat sitting on his human’s lap.

020

Reposted by አዲስ

Communies @communiess.bsky.social · 20/09/2026

Happy #BatmanDay to all who celebrate.

34314

Reposted by አዲስ

Nina Willburger @drnwillburger.bsky.social · 14/09/2026

The Venus of Willendorf: A 29,500‑year‑old masterpiece and one of the most iconic works of Paleolithic art. Standing just 11.1 cm tall, the figurine was carved from oolitic limestone and originally coated with red ochre, a pigment that still leaves faint traces today. 🧵1/2 📷 me #archaeology

A front-facing photograph of a small, pale limestone female figurine, centered against a deep black museum-display background. The figure has a rounded body with prominent breasts, a full abdomen, broad hips, and short legs, the feet are broken off; her thin arms rest on her breasts. Her head is covered with closely carved horizontal bands or braided-looking grooves, no visible facial features.

8454115

Reposted by አዲስ

Jeff VanderMeer @jeffvandermeer.bsky.social · 11/09/2026

i just cant be bothered to read about tiramisu

81305

አዲስ @uusisuru.bsky.social · 10/09/2026

Today’s #pinstory … because #onthisday in 1993, The X-Files premiered.

Two enamel pins on a dark blue work shirt collar. The pins are the work of Robin Eisenberg. One is of Fox Mulder saying “Trust me, Scully.” The other is of Dana Scully saying “Mulder, it’s me.”

010

አዲስ @uusisuru.bsky.social · 09/09/2026

Remembering James Earl Jones who died #onthisday in 2024

010

Reposted by አዲስ

Tomb Heintjes @hogansalley.bsky.social · 07/09/2026

Happy Labor Day from Hogan’s Alley!

06415

አዲስ @uusisuru.bsky.social · 06/09/2026

Spotted this vintage hardcover book at an antiques fair. Price tag: $50

“Michael Gets the Measles” by Marguerite Rush Lerner, M.D. and illustrated by George Overlie

The cover has a stylized illustration of a child in his striped pajamas, sitting on the edge of the bed, inspecting some spots on his neck with a handheld mirror, while an obedient dog sits in front of him, looking on. The cover is mostly orange-red, with black lines and white highlights.

010

አዲስ @uusisuru.bsky.social · 05/09/2026

Why did I order my favorite food if I’m recovering from rhinitis and can’t taste/smell anything? 🫠

110

አዲስ @uusisuru.bsky.social · 03/09/2026

I have a cat I have to administer medicine to everyday. His “spoonful of sugar” that helps the medicine go down is a tuna and Pedialyte cocktail.

static.klipy.com

Mary Poppins' Magical Taste

ALT: Mary Poppins' Magical Taste

110

Reposted by አዲስ

Medieval Military Medicine @medmilmedicine.bsky.social · 03/09/2026

The mood on the ark began to change once Noah ran out of seasickness tablets for the animals - 13th century, Bibliothèque de l'Arsenal, Ms-1186 réserve, f. 13v

05114

Reposted by አዲስ

Nina Willburger @drnwillburger.bsky.social · 01/09/2026

A #Roman helmet with a face mask found in Pfrondorf. It's decorated with wings and snakes, a reference to Medusa, the snake-haired mythical creature whose sight turned everyone who saw it to stone. Medusa’s head was a popular motif used to ward off any evil. 🧵1/2 📷 Landesmuseum Württemberg

The photo shows a Roman cavalry helmet with a face mask made of silver plated bronze. An eagle is perched on the forehead. It's framed by wings and snakes.

528449

አዲስ @uusisuru.bsky.social · 01/09/2026

I just bought a dozen eggs for 75¢ 😱

010

አዲስ @uusisuru.bsky.social · 31/08/2026

How did I miss this headline? 💔

110