Fish | D.N.A ceo @fishgamign.bsky.social · 25/09/2026 If Yunyun has a milion fans, I am one of them. If Yunyun has ten fans, I am one of them. If Yunyun has only one fan, that is me. If Yunyun has no fans, I no longer exist on this earth. If the whole world is against Yunyun, I am against the whole world. 010
Fish | D.N.A ceo @fishgamign.bsky.social · 24/09/2026I HAVE RECIEVED THE SIGNAL yunyunyunyunynuynuynuynunyunyunynuynuynunyunyunyunynuynunyunyun 011
Reposted by Fish | D.N.A ceoblue @gloomboyszn.bsky.social · 13/08/2026btw if you still consume and promote new harry potter media you are a bad person point blank. and the more you try to defend yourself the more trans kids will die and be stripped off their humanity bc you keep funding that shit so go fuck yourself there really is no excuse any more 07644
Fish | D.N.A ceo @fishgamign.bsky.social · 12/08/2026what videogame would you erase all memories of from yourself just to experience it for the first time again i'll start Splatoon 2 Octo Expansion 310
Fish | D.N.A ceo @fishgamign.bsky.social · 26/07/2026saw a tiktoker conspiracyposting, and then they immediately slid into a crypto ad 100
Fish | D.N.A ceo @fishgamign.bsky.social · 26/07/2026it really sucks how you alone are the one solely responsible for preventing forest fires 111
Fish | D.N.A ceo @fishgamign.bsky.social · 18/07/2026The comic con worker watching me shout “Ja-orange” as I hurl a mouse at the nearest child 050
Reposted by Fish | D.N.A ceomollystars { comms 20% OFF!! } @mollystars.dev · 30/06/2026Big Jaboner! Down The Lane 633841
Fish | D.N.A ceo @fishgamign.bsky.social · 05/07/2026when i type gaster as my username when creating a new bluesky account and bluesky turns into some random 90s web forum 110
Reposted by Fish | D.N.A ceoaagaming @aagaming.me · 05/07/2026end all aibros immediately we have moved on from idiots blatantly violating gpl to idiots asking ai to do things and ai blatantly violating gpl to do them 49018
Reposted by Fish | D.N.A ceo𝕹𝖞𝖝 妛彁 @nyx-land.bsky.social · 04/07/2026death to amerikkka of course 14413
Reposted by Fish | D.N.A ceo𝐃𝐄𝐕𝐎𝐍 𝐈𝐍 𝐇𝐄𝐋𝐋™ @devononearth.bsky.social · 04/07/2026Liberals frustrate me to no end because you can tell they really think that America is a good idea at the core and thats just not true. You see the shade of it in this hope that Trump dies today and the whole world celebrates the 4th of July going forward 1249959
Fish | D.N.A ceo @fishgamign.bsky.social · 03/07/2026me when i get stuck in a doomed timeline in SBURB so i rename a consort GASTER so i get sent back to before the session started 100
Fish | D.N.A ceo @fishgamign.bsky.social · 01/07/2026i mean if i even can artfight is actively shitting the bed 000
Fish | D.N.A ceo @fishgamign.bsky.social · 24/06/2026if you're playing chapter 5 play the weird route first trust me on everything 100
Fish | D.N.A ceo @fishgamign.bsky.social · 22/06/2026when the opps got sentient ai so you lowkey gotta ⬆️⬇️⬆️➡️➡️⬅️🅰️⚪⚫ act now ⚪ 110
Fish | D.N.A ceo @fishgamign.bsky.social · 20/06/2026you'll be on a walk and find the most beautiful flowers and google wil ltell you "yeah this is bitchum assidae and its a highly invasive flower that kills firstborn children and literally created global warming" like fuck i cant have anything good in life who the fuck likes flowers thats gay as hell 020
Fish | D.N.A ceo @fishgamign.bsky.social · 19/06/2026aaaaaaaaaaaand the leaks were real fuck my stupid chungus life 130
Fish | D.N.A ceo @fishgamign.bsky.social · 17/06/2026Now the question is... if FRIEND is going to be the CH5 Snowgrave final boss, and the pattern indicates Ralsei is going to be fighting this boss solo... What the utter hell is going on in the normal route? 010
Fish | D.N.A ceo @fishgamign.bsky.social · 17/06/2026Now, what are we training for? DIGITAL ROOTS is the first place where you will see it. IMAGE_FRIEND. The Tail of Hell. I believe that Kris and Noelle's training is for that very purpose, making them strong enough to be able to take down FRIEND. 110
Fish | D.N.A ceo @fishgamign.bsky.social · 17/06/2026In BIT ROOTS, the map layout seems to resemble Hometown, with each room layout having a connection to its resembling area. The room that represents the school has an area with hometown trees that are to be cut through. This takes you to a corridor heavily implied to be connected to DIGITAL ROOTS. 110
Fish | D.N.A ceo @fishgamign.bsky.social · 17/06/2026(This is foreshadowed in BIT ROOTS ch3) Progression throughout the dark world is primarily going to focus on training up Kris so that they get sufficiently strong, seeing as we've already trained up Noelle enough. (Note: Since noelle is gonna be with us... SNOWGRAVE's back on the menu) 110
Fish | D.N.A ceo @fishgamign.bsky.social · 17/06/2026It starts off with the festival, which, as we know, Kris is going with Noelle to. At some point during the festival, ASGORE is going to open a dark world somewhere that covers the whole town. 110
Fish | D.N.A ceo @fishgamign.bsky.social · 17/06/2026I'm going to predict how chapter 5 snowgrave's gonna go (even though i have no clue how its gonna go normally) 320
Fish | D.N.A ceo @fishgamign.bsky.social · 16/06/2026"Everyone is my servant they just dont know it yet" oh BROTHER this guy STINKS #vaguepost 100
Fish | D.N.A ceo @fishgamign.bsky.social · 15/06/2026SPONGE BOY ME BOB IVE SEQUENCED THE HUMAN GENOME AGCAGCAGCGGCAGCAGATACACGTACGATGC 110
Reposted by Fish | D.N.A ceoiby @burgeroise.bsky.social · 15/06/2026this 102 year old anime franchise still warps sexual development the old fashioned way 16837241
Fish | D.N.A ceo @fishgamign.bsky.social · 14/06/2026there is no fucking way americas funniest home videos is still occuring FYM ITS BEEN AROUND SINCE 1989 AND IS STILL GOING 220
Reposted by Fish | D.N.A ceoThe Hedonistic Pervert @photonmarie.bsky.social · 14/06/2026this video is phenomenal 51622715
Fish | D.N.A ceo @fishgamign.bsky.social · 12/06/2026who are the original people in the weed smoking girlfriends picture 100
Fish | D.N.A ceo @fishgamign.bsky.social · 12/06/2026yo googly moogly i just drank a glass of evil water am i sound 120
Fish | D.N.A ceo @fishgamign.bsky.social · 03/06/2026damn i forgot i unironically used to pretend to be miku 100
Fish | D.N.A ceo @fishgamign.bsky.social · 03/06/2026there is a mf who survived the titanic named JOHN DIAPER 100
Reposted by Fish | D.N.A ceo🎆 oceaned min 🎆 @oceanminex.myatproto.social · 30/05/2026Repost to scare Bluesky developers 22212011414