Fish | D.N.A ceo @fishgamign.bsky.social · 25/09/2026 If Yunyun has a milion fans, I am one of them. If Yunyun has ten fans, I am one of them. If Yunyun has only one fan, that is me. If Yunyun has no fans, I no longer exist on this earth. If the whole world is against Yunyun, I am against the whole world. 010
Reposted by Fish | D.N.A ceoblue @gloomboyszn.bsky.social · 13/08/2026btw if you still consume and promote new harry potter media you are a bad person point blank. and the more you try to defend yourself the more trans kids will die and be stripped off their humanity bc you keep funding that shit so go fuck yourself there really is no excuse any more 07644
Fish | D.N.A ceo @fishgamign.bsky.social · 12/08/2026what videogame would you erase all memories of from yourself just to experience it for the first time again i'll start Splatoon 2 Octo Expansion 310
Fish | D.N.A ceo @fishgamign.bsky.social · 26/07/2026saw a tiktoker conspiracyposting, and then they immediately slid into a crypto ad 100
Fish | D.N.A ceo @fishgamign.bsky.social · 26/07/2026it really sucks how you alone are the one solely responsible for preventing forest fires 111
Fish | D.N.A ceo @fishgamign.bsky.social · 18/07/2026The comic con worker watching me shout “Ja-orange” as I hurl a mouse at the nearest child 050
Reposted by Fish | D.N.A ceomollystars { comms open!! } @mollystars.dev · 30/06/2026Big Jaboner! Down The Lane 633841
Fish | D.N.A ceo @fishgamign.bsky.social · 05/07/2026when i type gaster as my username when creating a new bluesky account and bluesky turns into some random 90s web forum 110
Reposted by Fish | D.N.A ceoaagaming @aagaming.me · 05/07/2026end all aibros immediately we have moved on from idiots blatantly violating gpl to idiots asking ai to do things and ai blatantly violating gpl to do them 49018
Reposted by Fish | D.N.A ceo𝕹𝖞𝖝 妛彁 @nyx-land.bsky.social · 04/07/2026death to amerikkka of course 14413
Reposted by Fish | D.N.A ceo𝐃𝐄𝐕𝐎𝐍™ @devononearth.bsky.social · 04/07/2026Liberals frustrate me to no end because you can tell they really think that America is a good idea at the core and thats just not true. You see the shade of it in this hope that Trump dies today and the whole world celebrates the 4th of July going forward 1250059
Fish | D.N.A ceo @fishgamign.bsky.social · 03/07/2026me when i get stuck in a doomed timeline in SBURB so i rename a consort GASTER so i get sent back to before the session started 100
Fish | D.N.A ceo @fishgamign.bsky.social · 24/06/2026if you're playing chapter 5 play the weird route first trust me on everything 100
Fish | D.N.A ceo @fishgamign.bsky.social · 22/06/2026when the opps got sentient ai so you lowkey gotta ⬆️⬇️⬆️➡️➡️⬅️🅰️⚪⚫ act now ⚪ 110
Fish | D.N.A ceo @fishgamign.bsky.social · 20/06/2026you'll be on a walk and find the most beautiful flowers and google wil ltell you "yeah this is bitchum assidae and its a highly invasive flower that kills firstborn children and literally created global warming" like fuck i cant have anything good in life who the fuck likes flowers thats gay as hell 020
Fish | D.N.A ceo @fishgamign.bsky.social · 19/06/2026aaaaaaaaaaaand the leaks were real fuck my stupid chungus life 130
Fish | D.N.A ceo @fishgamign.bsky.social · 17/06/2026I'm going to predict how chapter 5 snowgrave's gonna go (even though i have no clue how its gonna go normally) 320
Fish | D.N.A ceo @fishgamign.bsky.social · 16/06/2026"Everyone is my servant they just dont know it yet" oh BROTHER this guy STINKS #vaguepost 100
Fish | D.N.A ceo @fishgamign.bsky.social · 15/06/2026SPONGE BOY ME BOB IVE SEQUENCED THE HUMAN GENOME AGCAGCAGCGGCAGCAGATACACGTACGATGC 110
Reposted by Fish | D.N.A ceoiby @burgeroise.bsky.social · 15/06/2026this 102 year old anime franchise still warps sexual development the old fashioned way 16837241
Fish | D.N.A ceo @fishgamign.bsky.social · 14/06/2026there is no fucking way americas funniest home videos is still occuring FYM ITS BEEN AROUND SINCE 1989 AND IS STILL GOING 220
Reposted by Fish | D.N.A ceoThe Hedonistic Pervert @photonmarie.bsky.social · 14/06/2026this video is phenomenal 51621716
Fish | D.N.A ceo @fishgamign.bsky.social · 12/06/2026who are the original people in the weed smoking girlfriends picture 100
Fish | D.N.A ceo @fishgamign.bsky.social · 12/06/2026yo googly moogly i just drank a glass of evil water am i sound 120
Fish | D.N.A ceo @fishgamign.bsky.social · 03/06/2026there is a mf who survived the titanic named JOHN DIAPER 100
Reposted by Fish | D.N.A ceo🎆 oceaned min 🎆 @oceanminex.myatproto.social · 30/05/2026Repost to scare Bluesky developers 22212311419
Reposted by Fish | D.N.A ceocornish person girl @gemma.transwrites.world · 26/05/2026everyone is making the EHRC stuff sound complicated but it's actually very easy I will either use the women's room like any other woman or you can kick me out and I'll come back with a hammer and noone can use the women's room at all. 216424
Fish | D.N.A ceo @fishgamign.bsky.social · 25/05/2026comfortmaxxing things done = none warmth = comfortable blankets = ON scrolling = DOOM 050
Fish | D.N.A ceo @fishgamign.bsky.social · 24/05/2026Look Mac, that guy may look threatening, but at least he'll honor a good fight. Make sure to stay out of range of his blade, and go for that ring. You're basically set to win from there, Mac. 0132
Reposted by Fish | D.N.A ceoKanna Banana 🏳️⚧️🇧🇷 @kanna-banana.bsky.social · 24/05/2026group screaming hour starts in 30 minutes 2330891262
Reposted by Fish | D.N.A ceothemboy insomniac @riotliturgist.bsky.social · 22/05/2026children are an oppressed class 532878
Fish | D.N.A ceo @fishgamign.bsky.social · 23/05/2026sorry ive been inactive been busy laying 1000 damn daniel eggs 110
Fish | D.N.A ceo @fishgamign.bsky.social · 21/05/2026this fucking performative purity culture slop with gameoverse is genuinely pissing me off 050
Fish | D.N.A ceo @fishgamign.bsky.social · 18/05/2026computer make the reader super cute what do you mean nothing changed 142
Fish | D.N.A ceo @fishgamign.bsky.social · 13/05/2026i honestly cant believe bedtime used to be a punishment 110