iiinova — where your digital self keeps evolving

Reposted by James Cotton

Rod Page @rdmpage.bsky.social · 23/09/2026

Jobs galore at @nhm-london.bsky.social @dissco.bsky.social - jobs.nhm.ac.uk/Job/JobDetai... - jobs.nhm.ac.uk/Job/JobDetai... - jobs.nhm.ac.uk/Job/JobDetai... - jobs.nhm.ac.uk/Job/JobDetai... - jobs.nhm.ac.uk/Job/JobDetai... including Heads of Digitisation and Technical Innovation

jobs.nhm.ac.uk

DiSSCo UK Digitiser:South Kensington

0412

James Cotton @jamesacotton.bsky.social · 07/09/2026

I'm biased, but I think its a fantastic project, working with an amazing dataset that Liz has generated. We are looking for someone with strong genetic data analysis skills, but who can also translate genetic results into advice for the program, so communication is as important as technical skills

110

James Cotton @jamesacotton.bsky.social · 07/09/2026

A post-doctoral position is available with Liz Thiele and I working on Guinea worm population genetics in support of the eradication program. Currently funded for a fairly short time, but with prospects of funding renewal.

142

Reposted by James Cotton

Kathryn R Elmer @profkathrynelmer.bsky.social · 25/08/2026

We have a ca 1.5 yr postdoc available in our team, asking, 'what is the shape of the fitness landscape between oviparity and viviparity?' and 'what drives viviparity to evolve'? 🧬 using 🦎 as a model. closes 16 Sept. Details on EvolDir evoldir.net/brian/evoldi... @glasgow.ac.uk @sbohvm.gla.ac.uk

11316

James Cotton @jamesacotton.bsky.social · 21/05/2026

We are looking for people with previous population genetics experience both in the lab and analysis, and with a passion for applying these techniques in the context of disease control.

100

James Cotton @jamesacotton.bsky.social · 21/05/2026

We are recruiting! - looking for a post-doc to lead on the genetics part of a large multi-disciplinary study of the drivers of persistent schistosomiasis infection and re-infection with a bunch of great partners in Glasgow, the UK, Cameroon, Côte d'Ivoire and Malawi.

jobs.gla.ac.uk

Research Assistant/Associate

Job PurposeYou will contribute to/make a leading contribution to the project ‘Identifying drivers of schistosomiasis treatment failure and recommendations for treatment strategies (DRIVERS)’ workin...

125

James Cotton @jamesacotton.bsky.social · 18/05/2026

Exactly this, except I was mostly too impatient so my Dad ended up typing most of them

010

Reposted by James Cotton

Adam Hayward @adhayward.bsky.social · 10/04/2026

Exciting PhD opportunity on the ecological impacts of anthelmintic use on soil fauna, with a crack supervisory team and expertise from @glasgow.ac.uk, @hutton.ac.uk and @moredunfoundation.bsky.social! Find more details here: www.findaphd.com/phds/project...

findaphd.com

043

James Cotton @jamesacotton.bsky.social · 10/04/2026

There is a PhD position on ecological impacts of anthelmintic usage on soil fauna. A great team of supervisors from 3 Scottish institutions.. fully funded for EU and UK applicants. www.findaphd.com/phds/project...

findaphd.com

010

James Cotton @jamesacotton.bsky.social · 03/04/2026

Don't know about the weirdest, but St Swithun seems like the most British, who has doomed us to rainy summers because he didn't get buried in the rain like he wanted (or something like that..). Having read wikipedia, it seems like this might not be entirely historically accurate.

100

James Cotton @jamesacotton.bsky.social · 19/02/2026

Roz Laing and I are looking for a combined lab manager/(PD)RA to contribute to ongoing projects in the lab: initially for 18 months but hopefully a longer-term post, subject to funding. Closing date is 23 March. Please get in touch if you have any questions about the role. tinyurl.com/246m632j

tinyurl.com

Research Assistant

We have an exciting opportunity for a Research Assistant to contribute to multiple veterinary parasitology projects, working with Professor James Cotton and Dr Roz Laing. The successful candidate w...

016

James Cotton @jamesacotton.bsky.social · 14/02/2026

I discovered by accident that you need to go to builders merchants for blue roll.. on Great Western Road. www.screwfix.com/p/essentials...

010

James Cotton @jamesacotton.bsky.social · 24/12/2025

Please also note that only a limited number of NorthwestBio studentships will be funded for international students, so competition for those places is likely to be extremely competitive.

000

James Cotton @jamesacotton.bsky.social · 24/12/2025

Please note that you *must* apply through the NorthWest Bio system by 4th January at lnkd.in/etRp8szS. Writing to me or the other supervisors won't be counted as a valid application in time. www.gla.ac.uk/postgraduate... www.gla.ac.uk/postgraduate... www.gla.ac.uk/postgraduate...

lnkd.in

This link will take you to a page that’s not on LinkedIn

100

James Cotton @jamesacotton.bsky.social · 24/12/2025

A slightly late pre-xmas reminder to please apply for these funded PhD positions in parasite genomics/genetics/molecular biology that I'm involved in – the closing date was extended and is now 4th January, so still time to put together an application.

lnkd.in

This link will take you to a page that’s not on LinkedIn

101

James Cotton @jamesacotton.bsky.social · 11/11/2025

I'm afraid i'm lowkey(generation_x). Proudly part of the first generation to be raised by video games and MTV.

010

James Cotton @jamesacotton.bsky.social · 11/11/2025

Looking forward to seeing the R code for your next paper...

100

Reposted by James Cotton

Roman Biek @rbiek.bsky.social · 09/11/2025

Come join us - we are recruiting a postdoc in phylodynamics and epidemiological modelling to join an exciting project on foot-and-mouth-disease virus in African buffalo www.jobs.gla.ac.uk/job/research... Please share widely! #jobs #disease #ecology #evolution #phylodynamics

jobs.gla.ac.uk

Research Assistant/Associate

Job Purpose You will contribute to an international collaborative project entitled “Multi-scale infection dynamics from cells to landscapes: FMD in African buffalo”, working with Prof Roman Biek. T...

097

James Cotton @jamesacotton.bsky.social · 07/11/2025

This scheme funds PhD scholarships in Glasgow for black UK-domiciled students. I'm happy to support students interested in my research area, or try and help point potential applicants to more suitable supervisors if your interests don't quite match mine.

010

Reposted by James Cotton

Richard McCulloch @rmc9z.bsky.social · 06/10/2025

Our lab has two funded PhDs to start in 2026 via the NorthWestBio programme Project details here www.gla.ac.uk/postgraduate... ...and here www.gla.ac.uk/postgraduate... Application deadline is Nov 21st 2025; apply here: www.gla.ac.uk/postgraduate...

gla.ac.uk

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Richard McCulloch

0105

James Cotton @jamesacotton.bsky.social · 07/10/2025

My colleague Roz Laing also has a veterinary parasitology project next year, investigating how epigenetics might be involved in mediating drug resistance in parasitic nematodes www.gla.ac.uk/postgraduate....

gla.ac.uk

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Roz Laing

020

James Cotton @jamesacotton.bsky.social · 07/10/2025

#3 Developing improved molecular diagnostics for Cryptosporidium in drinking water, and using these (and some genomics) to understand sources of contamination. Led by Frank Katzer at Moredun and Willie Weir in Glasgow www.gla.ac.uk/postgraduate...

gla.ac.uk

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Animal Biology in Health & Disease - Willie Weir

010

James Cotton @jamesacotton.bsky.social · 07/10/2025

#2 - a project taking a comparative approach to DNA replication and plasticity/mutation in kinetoplastids, expanding work form the 'model' parasites to other kinetoplastid lineages, with Richard McCulloch and Sarah Allinson in Lancaster: www.gla.ac.uk/postgraduate...

gla.ac.uk

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Richard McCulloch

031

James Cotton @jamesacotton.bsky.social · 07/10/2025

I'm also co-supervising a few other projects: #1: an inter-disciplinary project on chemical biology of Base-J in kinetoplastids, led by Glenn Burley @Strathclyde. We aim to develop some new chemical approaches and apply them to study kinetoplastid genetics. www.gla.ac.uk/postgraduate...

gla.ac.uk

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Underpinning Bioscience - Glenn A Burley

051

James Cotton @jamesacotton.bsky.social · 07/10/2025

The link currently has the wrong text, but hopefully will be fixed soon. Please get in touch if you have questions, and apply by 21st November via the NorthWestBio system www.gla.ac.uk/postgraduate...

gla.ac.uk

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - How To Apply

NorthWest Bio is a new BBSRC-funded doctoral training partnership. Discover more about the programme and how to apply.

010

James Cotton @jamesacotton.bsky.social · 07/10/2025

We have a PhD position in population genomics of sheep scab mites available from October 2026. The project will investigate Psoroptes populations in the context of eradication programs on Scottish island groups and spreading drug resistance. www.gla.ac.uk/postgraduate...

gla.ac.uk

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Animal Biology in Health & Disease - James Cotton

143

James Cotton @jamesacotton.bsky.social · 27/06/2025

Univariate Regression Road Non-Parametric Parade If I ever build a housing estate, there will be no 'Oak Avenue'

000

Reposted by James Cotton

Dr. Jen Irwin @drjenirwin.bsky.social · 21/03/2025

Academic colleagues, if we claim to value equity, and if it’s currently not safe for *some* of our colleagues to travel to the US for conferences, then should *any* of us be travelling to the US? Standing up for equity isn’t about our own convenience.

3294

James Cotton @jamesacotton.bsky.social · 10/03/2025

Possibly limited engagement. Does your network on here reach enough trilobite systematics influencers?

000

James Cotton @jamesacotton.bsky.social · 10/03/2025

not completely, but its good that you are so motivated to look less like me.

000

James Cotton @jamesacotton.bsky.social · 10/03/2025

Did you notice any way people can donate to the 'debt buying company' or similar things? Obviously I don't know the numbers but it seems like could be quite cost-effective philanthropy. We almost look like twins in our bsky profile pictures.. 😧

200

Reposted by James Cotton

Trevor @trevorcotton.bsky.social · 10/03/2025

@mchshe.bsky.social Reading the Guardian this morning. You seem to be a good man. Your comment on powerlessness really resonated… I need to do more, and am fortunate enough to be able to make some small difference. Well done!

121

James Cotton @jamesacotton.bsky.social · 03/03/2025

Tapeworm Echinococcus multilocularis: TCGGTCCTTACCTTGCAGTTTTGTATG doi: 10.1074/jbc.M006091200. tapeworm Hymenolepis diminuita: SL1: CGGTCTTACCATAAAACTTGTATG SL2: CCGGTCTTACCTTGCAATTTTTGTATG SL3: AATCGGTCTTACTGTACTAACTTGTATG doi: 10.1186/s12915-020-00899-w. thats all I can think of just now.

000

James Cotton @jamesacotton.bsky.social · 03/03/2025

No worries - i'd forgotten the nematode literature on this so nice to remind myself. You did say 'keep it coming'.

110

James Cotton @jamesacotton.bsky.social · 03/03/2025

The plant nematode Globodera pallida and G. rostochiensis have a bunch of different SLs (van Bers NEM: Characterization of genes coding for small hypervariable peptides in Globodera rostochiensis, PhD thesis. 2008, Wageningen (our paper doi.org/10.1186/gb-2... confirms this G. pallida, table S6)

000

James Cotton @jamesacotton.bsky.social · 03/03/2025

The plant parasitic nematode Heterodera glycines has a bunch of alternative SLs too: (from doi.org/10.1038/s415...)

000

James Cotton @jamesacotton.bsky.social · 03/03/2025

There are a bunch of other SL sequences in C. elegans that are used less commonly than SL1 and SL2 - the table here is from International Journal of Parasitology Vol. 26. No. IO, pp. 1025-1033. 1996

010

James Cotton @jamesacotton.bsky.social · 26/02/2025

no worries - if i come across a good synthesis of the complex nematode ones I'll let you know. There is also trans-splicing in other flatworms, but not sure what the sequences are. It must be known in some e.g. Echinococcus and Hymenolepis, and probably Fasciola too.

010

James Cotton @jamesacotton.bsky.social · 26/02/2025

And this one in Schistosomes: AACCGTCACGGTTTTACTCTTGTGATTTGTTGCATG I think PMID: 2247461 is the original reference

010

James Cotton @jamesacotton.bsky.social · 26/02/2025

and some more in other nematodes: van Bers NEM: Characterization of genes coding for small hypervariable peptides in Globodera rostochiensis, PhD thesis. 2008, Wageningen: Wageningen University. I suspect there are a bunch in nematodes, but i'm not sure if there is a good single list somewhere..

110